Incidental Mutation 'R0655:Atg16l1'
ID62457
Institutional Source Beutler Lab
Gene Symbol Atg16l1
Ensembl Gene ENSMUSG00000026289
Gene Nameautophagy related 16-like 1 (S. cerevisiae)
Synonyms1500009K01Rik, APG16L, WDR30
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0655 (G1)
Quality Score124
Status Not validated
Chromosome1
Chromosomal Location87755870-87792428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87766829 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 76 (I76N)
Ref Sequence ENSEMBL: ENSMUSP00000120955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190] [ENSMUST00000144047]
Predicted Effect probably damaging
Transcript: ENSMUST00000027512
AA Change: I138N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: I138N

DomainStartEndE-ValueType
Pfam:ATG16 13 207 1.3e-63 PFAM
low complexity region 237 246 N/A INTRINSIC
WD40 311 350 7.05e-9 SMART
WD40 355 394 7.28e-2 SMART
WD40 397 436 1.07e-8 SMART
WD40 439 475 3.7e0 SMART
WD40 478 516 5.35e-1 SMART
WD40 519 562 1.2e-2 SMART
WD40 565 605 6.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113186
AA Change: I138N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: I138N

DomainStartEndE-ValueType
Pfam:ATG16 13 207 3.7e-64 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
WD40 292 331 7.05e-9 SMART
WD40 336 375 7.28e-2 SMART
WD40 378 417 1.07e-8 SMART
WD40 420 456 3.7e0 SMART
WD40 459 497 5.35e-1 SMART
WD40 500 543 1.2e-2 SMART
WD40 546 586 6.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113190
AA Change: I138N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: I138N

DomainStartEndE-ValueType
Pfam:ATG16 16 206 6.5e-49 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
WD40 327 366 7.05e-9 SMART
WD40 371 410 7.28e-2 SMART
WD40 413 452 1.07e-8 SMART
WD40 455 491 3.7e0 SMART
WD40 494 532 5.35e-1 SMART
WD40 535 578 1.2e-2 SMART
WD40 581 621 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137638
Predicted Effect probably damaging
Transcript: ENSMUST00000144047
AA Change: I76N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120955
Gene: ENSMUSG00000026289
AA Change: I76N

DomainStartEndE-ValueType
Pfam:ATG16 1 145 2.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151037
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Atg16l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Atg16l1 APN 1 87765397 missense possibly damaging 0.68
IGL00861:Atg16l1 APN 1 87774838 missense probably damaging 1.00
IGL01065:Atg16l1 APN 1 87785931 missense probably damaging 0.99
IGL01068:Atg16l1 APN 1 87774824 missense probably damaging 1.00
IGL01140:Atg16l1 APN 1 87774853 missense probably benign 0.03
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0650:Atg16l1 UTSW 1 87781699 missense possibly damaging 0.93
R1421:Atg16l1 UTSW 1 87786358 splice site probably benign
R1549:Atg16l1 UTSW 1 87774188 missense probably benign
R2202:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R2204:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R3689:Atg16l1 UTSW 1 87785904 missense probably damaging 1.00
R4012:Atg16l1 UTSW 1 87766907 missense probably damaging 1.00
R4391:Atg16l1 UTSW 1 87760120 missense probably damaging 0.97
R4839:Atg16l1 UTSW 1 87766174 missense probably damaging 0.99
R4935:Atg16l1 UTSW 1 87767042 missense possibly damaging 0.69
R4980:Atg16l1 UTSW 1 87766831 missense possibly damaging 0.89
R4990:Atg16l1 UTSW 1 87789369 missense probably benign 0.00
R5011:Atg16l1 UTSW 1 87774180 nonsense probably null
R5457:Atg16l1 UTSW 1 87775091 missense probably damaging 0.96
R5897:Atg16l1 UTSW 1 87785997 critical splice donor site probably null
R6289:Atg16l1 UTSW 1 87756215 missense probably damaging 0.99
R6437:Atg16l1 UTSW 1 87790648 missense probably damaging 1.00
R6727:Atg16l1 UTSW 1 87774854 missense possibly damaging 0.68
R6923:Atg16l1 UTSW 1 87774356 intron probably null
R7423:Atg16l1 UTSW 1 87786301 missense probably damaging 1.00
R7475:Atg16l1 UTSW 1 87760083 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCCACTTGGAAATGCCTGGAG -3'
(R):5'- AGCCATCCATCTGGTGACCAGTTC -3'

Sequencing Primer
(F):5'- AAGCTACAGTTACTAGCCGTCTG -3'
(R):5'- CTGGTGACCAGTTCCTGGTTC -3'
Posted On2013-07-30