Incidental Mutation 'R0655:Tnfrsf11a'
ID62459
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Nametumor necrosis factor receptor superfamily, member 11a, NFKB activator
SynonymsTRANCE-R, Rank
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R0655 (G1)
Quality Score93
Status Not validated
Chromosome1
Chromosomal Location105780718-105847981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105808155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 31 (V31I)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
PDB Structure
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000027559
AA Change: V31I
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: V31I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187812
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105809422 missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105827718 missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105821517 missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105844857 nonsense probably null
R0514:Tnfrsf11a UTSW 1 105826992 missense probably damaging 1.00
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105844705 missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105827061 missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105809405 missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3818:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4039:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4238:Tnfrsf11a UTSW 1 105827237 missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105813820 intron probably null
R6102:Tnfrsf11a UTSW 1 105819946 missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105844546 missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105844695 missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105827539 missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105808141 critical splice acceptor site probably null
R7323:Tnfrsf11a UTSW 1 105844730 missense probably damaging 1.00
R7334:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGGTCAGAGCCCTGTGCTAAAAG -3'
(R):5'- GAGAGGCAAATGTCACTGCCTACC -3'

Sequencing Primer
(F):5'- AGCCCTGTGCTAAAAGGTTTG -3'
(R):5'- ACCACTATCATGGAAGGTCTCTG -3'
Posted On2013-07-30