Incidental Mutation 'R0655:Pax5'
ID62466
Institutional Source Beutler Lab
Gene Symbol Pax5
Ensembl Gene ENSMUSG00000014030
Gene Namepaired box 5
SynonymsPax-5, EBB-1
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0655 (G1)
Quality Score135
Status Not validated
Chromosome4
Chromosomal Location44524757-44710487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44537462 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 297 (S297P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014174] [ENSMUST00000102932] [ENSMUST00000107825] [ENSMUST00000107826] [ENSMUST00000107827] [ENSMUST00000134968] [ENSMUST00000143235] [ENSMUST00000165417] [ENSMUST00000173733] [ENSMUST00000173821] [ENSMUST00000174242]
Predicted Effect probably benign
Transcript: ENSMUST00000014174
AA Change: S353P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000014174
Gene: ENSMUSG00000014030
AA Change: S353P

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 279 390 6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102932
SMART Domains Protein: ENSMUSP00000099996
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 276 341 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107825
AA Change: S319P

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103455
Gene: ENSMUSG00000014030
AA Change: S319P

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
Pfam:Pax2_C 279 356 5.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107826
SMART Domains Protein: ENSMUSP00000103457
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 7e-4 SMART
low complexity region 269 281 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000107827
SMART Domains Protein: ENSMUSP00000103458
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 4e-4 SMART
low complexity region 298 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134968
SMART Domains Protein: ENSMUSP00000133540
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 298 2.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143235
SMART Domains Protein: ENSMUSP00000134370
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165417
AA Change: S310P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128880
Gene: ENSMUSG00000014030
AA Change: S310P

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 347 7.3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172866
AA Change: S297P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134119
Gene: ENSMUSG00000014030
AA Change: S297P

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 7e-5 SMART
Pfam:Pax2_C 224 335 2.3e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173733
AA Change: S253P

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133671
Gene: ENSMUSG00000014030
AA Change: S253P

DomainStartEndE-ValueType
PAX 16 120 2.93e-30 SMART
SCOP:d1ftt__ 154 188 1e-4 SMART
Pfam:Pax2_C 212 290 8.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173821
SMART Domains Protein: ENSMUSP00000134712
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174242
SMART Domains Protein: ENSMUSP00000134391
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174319
SMART Domains Protein: ENSMUSP00000133978
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 2e-4 SMART
low complexity region 251 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194075
AA Change: S170P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Pax5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Pax5 APN 4 44691919 missense probably damaging 1.00
IGL02700:Pax5 APN 4 44682722 missense probably damaging 0.99
IGL02754:Pax5 APN 4 44570059 missense probably damaging 0.96
apple UTSW 4 unclassified
glacier UTSW 4 44679494 missense probably damaging 1.00
glacier2 UTSW 4 44710407 start codon destroyed probably null 0.96
Glacier3 UTSW 4 44679526 missense probably damaging 1.00
k2 UTSW 4 44697630 missense probably damaging 1.00
Son_of_apple UTSW 4 44710583 unclassified probably benign
R0411:Pax5 UTSW 4 44609783 missense probably damaging 0.99
R0415:Pax5 UTSW 4 44691886 missense probably damaging 1.00
R1146:Pax5 UTSW 4 44697512 splice site probably benign
R1752:Pax5 UTSW 4 44609729 missense probably damaging 1.00
R1891:Pax5 UTSW 4 44691859 missense probably damaging 1.00
R4766:Pax5 UTSW 4 44679494 missense probably damaging 1.00
R4783:Pax5 UTSW 4 44570086 missense probably damaging 1.00
R5134:Pax5 UTSW 4 44710407 start codon destroyed probably null 0.96
R5341:Pax5 UTSW 4 44697630 missense probably damaging 1.00
R5458:Pax5 UTSW 4 44679526 missense probably damaging 1.00
R6281:Pax5 UTSW 4 44691955 missense probably benign 0.37
R6871:Pax5 UTSW 4 44710583 unclassified probably benign
R7025:Pax5 UTSW 4 44679501 nonsense probably null
R7204:Pax5 UTSW 4 44679485 missense possibly damaging 0.93
S24628:Pax5 UTSW 4 44691886 missense probably damaging 1.00
X0018:Pax5 UTSW 4 44691880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGATAGAGGTTAGGCACCAGC -3'
(R):5'- ACAGCTCACTGGATGAGAGGATGAC -3'

Sequencing Primer
(F):5'- ttctcagcagccagcac -3'
(R):5'- GTTATTGGTTACCAAAAGCACCCG -3'
Posted On2013-07-30