Incidental Mutation 'R0655:Sbno1'
ID62471
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Namestrawberry notch 1
Synonyms9330180L10Rik, sno
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0655 (G1)
Quality Score148
Status Not validated
Chromosome5
Chromosomal Location124368702-124426001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124376149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1327 (V1327L)
Ref Sequence ENSEMBL: ENSMUSP00000130860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000199808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065263
AA Change: V1328L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095
AA Change: V1328L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168651
AA Change: V1327L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095
AA Change: V1327L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196842
Predicted Effect possibly damaging
Transcript: ENSMUST00000199808
AA Change: V1328L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095
AA Change: V1328L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124402205 missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124410249 missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124381706 missense probably benign 0.41
IGL01330:Sbno1 APN 5 124391979 missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124378555 splice site probably benign
IGL01800:Sbno1 APN 5 124381505 splice site probably benign
IGL01987:Sbno1 APN 5 124404219 missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124400195 splice site probably null
IGL02544:Sbno1 APN 5 124403983 missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124381677 splice site probably benign
IGL02592:Sbno1 APN 5 124400809 missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124376150 missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124387311 splice site probably benign
IGL03131:Sbno1 APN 5 124388605 missense probably damaging 1.00
Decrement UTSW 5 124400847 missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124404324 critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124386868 missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124410285 missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124410139 missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124386892 missense possibly damaging 0.79
R1037:Sbno1 UTSW 5 124393912 missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124384460 splice site probably benign
R1522:Sbno1 UTSW 5 124392612 missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124384504 missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124404216 missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124392067 splice site probably null
R1779:Sbno1 UTSW 5 124388517 unclassified probably benign
R2103:Sbno1 UTSW 5 124393937 missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124387534 synonymous probably null
R2149:Sbno1 UTSW 5 124402119 synonymous probably null
R2153:Sbno1 UTSW 5 124378543 missense probably benign
R2154:Sbno1 UTSW 5 124378511 missense probably benign
R2231:Sbno1 UTSW 5 124405704 missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124381708 missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124381930 missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124391920 critical splice donor site probably null
R4612:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124374609 missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124400165 missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124408475 critical splice donor site probably null
R5365:Sbno1 UTSW 5 124381866 frame shift probably null
R5399:Sbno1 UTSW 5 124392741 missense probably benign 0.09
R5704:Sbno1 UTSW 5 124395893 critical splice donor site probably null
R5898:Sbno1 UTSW 5 124386791 intron probably benign
R6136:Sbno1 UTSW 5 124378491 missense probably benign 0.41
R6154:Sbno1 UTSW 5 124378479 missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124392714 missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124395931 missense probably benign 0.28
R6454:Sbno1 UTSW 5 124400847 missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124381720 missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124392881 missense probably benign 0.21
R7219:Sbno1 UTSW 5 124405659 missense probably benign 0.00
Z1088:Sbno1 UTSW 5 124393958 missense possibly damaging 0.91
Z1088:Sbno1 UTSW 5 124404304 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGGTCAAATACCACTGGCTACC -3'
(R):5'- GACCGTCTCCATCCATTTGGAAAGG -3'

Sequencing Primer
(F):5'- agccatctcaccagccc -3'
(R):5'- GGCTAGACTCTACAGATATTCACG -3'
Posted On2013-07-30