Incidental Mutation 'R0655:Prx'
ID62482
Institutional Source Beutler Lab
Gene Symbol Prx
Ensembl Gene ENSMUSG00000053198
Gene Nameperiaxin
SynonymsL-Periaxin
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0655 (G1)
Quality Score171
Status Not validated
Chromosome7
Chromosomal Location27499324-27520214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27517421 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 449 (V449E)
Ref Sequence ENSEMBL: ENSMUSP00000145598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108355] [ENSMUST00000125990]
Predicted Effect probably damaging
Transcript: ENSMUST00000065487
AA Change: V588E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: V588E

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098644
AA Change: V588E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: V588E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125990
AA Change: V449E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Prx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prx APN 7 27519419 missense probably benign 0.12
IGL01702:Prx APN 7 27519787 missense probably benign 0.00
IGL02012:Prx APN 7 27517901 missense probably damaging 1.00
IGL02214:Prx APN 7 27518912 missense probably damaging 1.00
IGL02498:Prx APN 7 27518072 missense probably damaging 1.00
IGL03029:Prx APN 7 27508061 nonsense probably null
R0522:Prx UTSW 7 27518195 missense probably damaging 0.99
R0904:Prx UTSW 7 27518294 missense probably damaging 1.00
R1161:Prx UTSW 7 27519677 missense probably damaging 1.00
R1170:Prx UTSW 7 27518007 nonsense probably null
R1270:Prx UTSW 7 27518930 missense probably damaging 0.96
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1536:Prx UTSW 7 27517258 missense probably damaging 0.99
R1721:Prx UTSW 7 27517523 missense probably benign 0.19
R1815:Prx UTSW 7 27516665 missense probably damaging 1.00
R1848:Prx UTSW 7 27518888 missense possibly damaging 0.70
R1894:Prx UTSW 7 27519110 missense possibly damaging 0.68
R2179:Prx UTSW 7 27517985 missense probably benign
R2207:Prx UTSW 7 27516788 missense probably damaging 1.00
R2312:Prx UTSW 7 27516626 missense possibly damaging 0.87
R2356:Prx UTSW 7 27507859 start gained probably benign
R2519:Prx UTSW 7 27518243 missense probably benign 0.43
R2912:Prx UTSW 7 27516229 missense probably damaging 1.00
R4717:Prx UTSW 7 27516727 missense probably benign 0.07
R4868:Prx UTSW 7 27517579 missense probably benign 0.01
R5153:Prx UTSW 7 27518476 missense probably damaging 1.00
R5418:Prx UTSW 7 27517274 missense probably damaging 0.99
R5653:Prx UTSW 7 27517604 missense probably damaging 1.00
R5895:Prx UTSW 7 27515284 missense probably damaging 1.00
R6022:Prx UTSW 7 27517573 missense probably damaging 1.00
R6112:Prx UTSW 7 27516548 missense probably damaging 1.00
R6223:Prx UTSW 7 27516836 missense probably damaging 1.00
R6560:Prx UTSW 7 27515321 missense probably damaging 1.00
R6888:Prx UTSW 7 27519634 missense possibly damaging 0.73
X0028:Prx UTSW 7 27517733 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGAAAGTCCCAGAGATGAAGCTCC -3'
(R):5'- ATTTCAGGCAGCCGAATGTCCG -3'

Sequencing Primer
(F):5'- CCGAAGGTGCCCGAGATG -3'
(R):5'- GCACTTTGGGCAACTGAAC -3'
Posted On2013-07-30