Incidental Mutation 'R0655:Olfr694'
ID62485
Institutional Source Beutler Lab
Gene Symbol Olfr694
Ensembl Gene ENSMUSG00000064223
Gene Nameolfactory receptor 694
SynonymsMOR283-9, GA_x6K02T2PBJ9-9067220-9066273
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R0655 (G1)
Quality Score151
Status Not validated
Chromosome7
Chromosomal Location106684980-106691814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106689425 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 102 (F102Y)
Ref Sequence ENSEMBL: ENSMUSP00000151027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]
Predicted Effect probably damaging
Transcript: ENSMUST00000052535
AA Change: F102Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: F102Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082091
AA Change: F102Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: F102Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 7.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208331
Predicted Effect probably damaging
Transcript: ENSMUST00000216118
AA Change: F102Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216895
AA Change: F102Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Olfr694
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr694 APN 7 106689531 missense probably damaging 1.00
IGL01759:Olfr694 APN 7 106689333 missense probably benign 0.04
IGL02435:Olfr694 APN 7 106689503 missense probably benign 0.26
IGL02569:Olfr694 APN 7 106689642 missense probably benign 0.19
IGL02611:Olfr694 APN 7 106688789 missense probably benign 0.11
IGL02726:Olfr694 APN 7 106689370 nonsense probably null
IGL02944:Olfr694 APN 7 106689269 missense probably damaging 1.00
IGL03155:Olfr694 APN 7 106689239 missense probably damaging 1.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0609:Olfr694 UTSW 7 106688998 missense probably damaging 1.00
R1562:Olfr694 UTSW 7 106688980 missense probably benign 0.01
R1641:Olfr694 UTSW 7 106689711 missense probably benign 0.36
R2144:Olfr694 UTSW 7 106688957 missense probably damaging 0.99
R4416:Olfr694 UTSW 7 106689011 missense probably benign 0.07
R4444:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4445:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4567:Olfr694 UTSW 7 106689213 nonsense probably null
R4739:Olfr694 UTSW 7 106689144 nonsense probably null
R4778:Olfr694 UTSW 7 106689667 missense probably damaging 0.97
R4908:Olfr694 UTSW 7 106689533 missense probably damaging 1.00
R5244:Olfr694 UTSW 7 106689189 missense probably benign 0.12
R5944:Olfr694 UTSW 7 106689646 nonsense probably null
R6260:Olfr694 UTSW 7 106688872 missense probably damaging 1.00
R6573:Olfr694 UTSW 7 106689463 missense probably benign 0.00
R6901:Olfr694 UTSW 7 106689189 missense probably benign 0.03
R7230:Olfr694 UTSW 7 106689524 missense possibly damaging 0.94
U24488:Olfr694 UTSW 7 106689089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCTTTAGCAAGGGAGGAATC -3'
(R):5'- TGGACTGCTGCTTCTGGTCATCAC -3'

Sequencing Primer
(F):5'- TCTGCCTGGACTTGCAGAAAG -3'
(R):5'- ATCTTCTGCTATGGCAGCTC -3'
Posted On2013-07-30