Incidental Mutation 'R0655:Psd3'
ID62491
Institutional Source Beutler Lab
Gene Symbol Psd3
Ensembl Gene ENSMUSG00000030465
Gene Namepleckstrin and Sec7 domain containing 3
SynonymsEFA6D, 4931420C21Rik
MMRRC Submission 038840-MU
Accession Numbers

Ncbi RefSeq: NM_030263.5, NM_027626.1; MGI:1918215

Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0655 (G1)
Quality Score85
Status Not validated
Chromosome8
Chromosomal Location67689082-68212027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67963689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 519 (S519P)
Ref Sequence ENSEMBL: ENSMUSP00000148783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038959] [ENSMUST00000093469] [ENSMUST00000098696] [ENSMUST00000212505] [ENSMUST00000212960]
Predicted Effect probably benign
Transcript: ENSMUST00000038959
AA Change: S233P

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041339
Gene: ENSMUSG00000030465
AA Change: S233P

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 693 3.9e-53 SMART
PH 743 857 3.85e-15 SMART
Blast:Sec7 876 938 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093469
AA Change: S233P

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091179
Gene: ENSMUSG00000030465
AA Change: S233P

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098696
AA Change: S233P

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096293
Gene: ENSMUSG00000030465
AA Change: S233P

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
Blast:Sec7 431 496 5e-28 BLAST
Sec7 502 692 2.4e-53 SMART
PH 742 856 3.85e-15 SMART
Blast:Sec7 875 937 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212123
Predicted Effect probably benign
Transcript: ENSMUST00000212505
AA Change: S266P

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000212960
AA Change: S519P

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Psd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Psd3 APN 8 67908679 splice site probably benign
IGL01095:Psd3 APN 8 67908513 missense probably damaging 1.00
IGL01139:Psd3 APN 8 67908535 missense probably damaging 1.00
IGL01330:Psd3 APN 8 67697178 missense probably damaging 1.00
IGL01350:Psd3 APN 8 67720892 missense probably damaging 1.00
IGL01487:Psd3 APN 8 67697114 missense probably benign 0.01
IGL01780:Psd3 APN 8 67963869 missense probably benign
IGL02020:Psd3 APN 8 67974170 intron probably benign
IGL02232:Psd3 APN 8 67904145 missense probably damaging 1.00
IGL02350:Psd3 APN 8 67963869 missense probably benign
IGL02357:Psd3 APN 8 67963869 missense probably benign
PIT4495001:Psd3 UTSW 8 67963913 missense probably benign 0.00
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0581:Psd3 UTSW 8 67720946 missense probably damaging 1.00
R1740:Psd3 UTSW 8 68120839 missense probably damaging 1.00
R1789:Psd3 UTSW 8 67960565 missense probably benign 0.26
R1847:Psd3 UTSW 8 67720004 missense possibly damaging 0.93
R1951:Psd3 UTSW 8 67963487 missense probably benign 0.00
R1954:Psd3 UTSW 8 67697075 missense probably damaging 1.00
R2143:Psd3 UTSW 8 67964351 missense probably damaging 1.00
R4387:Psd3 UTSW 8 68000761 missense probably damaging 1.00
R4801:Psd3 UTSW 8 68121148 missense probably benign
R4802:Psd3 UTSW 8 68121148 missense probably benign
R4913:Psd3 UTSW 8 68121169 missense probably damaging 0.99
R5045:Psd3 UTSW 8 67713825 missense probably damaging 0.99
R5173:Psd3 UTSW 8 67696989 missense probably damaging 1.00
R5264:Psd3 UTSW 8 67713725 missense probably benign 0.23
R5350:Psd3 UTSW 8 67908861 missense probably benign 0.00
R5816:Psd3 UTSW 8 67960510 missense possibly damaging 0.90
R5994:Psd3 UTSW 8 67719968 missense probably damaging 1.00
R6157:Psd3 UTSW 8 68121527 start codon destroyed probably benign 0.14
R6241:Psd3 UTSW 8 67818139 intron probably benign
R6586:Psd3 UTSW 8 67963545 missense probably damaging 0.96
R6735:Psd3 UTSW 8 68120746 critical splice donor site probably null
R6908:Psd3 UTSW 8 67964177 missense probably benign 0.00
R6984:Psd3 UTSW 8 67818045 missense possibly damaging 0.85
R7082:Psd3 UTSW 8 67904148 missense probably benign 0.03
R7116:Psd3 UTSW 8 67713738 missense probably benign 0.12
R7297:Psd3 UTSW 8 68121034 missense probably damaging 0.98
R7334:Psd3 UTSW 8 67908705 missense possibly damaging 0.94
R7348:Psd3 UTSW 8 67790931 missense possibly damaging 0.65
R7357:Psd3 UTSW 8 68121497 missense probably benign 0.01
R7369:Psd3 UTSW 8 67904166 missense possibly damaging 0.95
R7385:Psd3 UTSW 8 68000756 missense probably damaging 1.00
Z1088:Psd3 UTSW 8 67906260 splice site silent
Predicted Primers PCR Primer
(F):5'- CACCACAAGCTGGGCTAGAATGAC -3'
(R):5'- TTTCAGCGGAAGTACCAACGGAG -3'

Sequencing Primer
(F):5'- TGGCCGTTTGGCAAACTC -3'
(R):5'- TCTTTGCACATCCAGGAGG -3'
Posted On2013-07-30