Incidental Mutation 'R0655:Mtmr3'
ID62505
Institutional Source Beutler Lab
Gene Symbol Mtmr3
Ensembl Gene ENSMUSG00000034354
Gene Namemyotubularin related protein 3
SynonymsFYVE-DSP1, 1700092A20Rik, ZFYVE10
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0655 (G1)
Quality Score91
Status Not validated
Chromosome11
Chromosomal Location4480868-4594863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4488610 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 615 (D615Y)
Ref Sequence ENSEMBL: ENSMUSP00000137687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]
Predicted Effect probably damaging
Transcript: ENSMUST00000040448
AA Change: D615Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: D615Y

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109943
AA Change: D615Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: D615Y

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123506
AA Change: D614Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: D614Y

DomainStartEndE-ValueType
Pfam:Myotub-related 126 524 1e-138 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1108 1177 7.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128256
AA Change: D614Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: D614Y

DomainStartEndE-ValueType
Pfam:Myotub-related 125 526 7.7e-149 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1071 1149 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130716
AA Change: D615Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354
AA Change: D615Y

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 2.2e-148 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155566
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Mtmr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Mtmr3 APN 11 4527861 missense probably damaging 1.00
IGL01808:Mtmr3 APN 11 4497404 missense probably damaging 1.00
IGL01994:Mtmr3 APN 11 4487938 missense probably benign
IGL02839:Mtmr3 APN 11 4487994 missense probably benign 0.03
IGL02893:Mtmr3 APN 11 4507632 missense possibly damaging 0.89
IGL03370:Mtmr3 APN 11 4487385 missense probably damaging 1.00
R0322:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R0363:Mtmr3 UTSW 11 4487536 missense probably damaging 0.99
R0866:Mtmr3 UTSW 11 4488474 missense probably benign 0.03
R1065:Mtmr3 UTSW 11 4492859 missense probably damaging 1.00
R1417:Mtmr3 UTSW 11 4487923 missense probably benign
R1698:Mtmr3 UTSW 11 4492825 missense possibly damaging 0.95
R1707:Mtmr3 UTSW 11 4504095 missense probably damaging 1.00
R2191:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R2192:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R3956:Mtmr3 UTSW 11 4491138 missense probably damaging 1.00
R4079:Mtmr3 UTSW 11 4491057 missense probably damaging 1.00
R4320:Mtmr3 UTSW 11 4487947 missense probably benign 0.39
R4577:Mtmr3 UTSW 11 4497375 missense probably damaging 1.00
R4622:Mtmr3 UTSW 11 4491067 missense possibly damaging 0.62
R4676:Mtmr3 UTSW 11 4527855 missense probably benign 0.12
R4726:Mtmr3 UTSW 11 4507634 missense probably damaging 1.00
R4781:Mtmr3 UTSW 11 4488435 missense probably benign 0.00
R4799:Mtmr3 UTSW 11 4487764 missense probably benign 0.12
R4810:Mtmr3 UTSW 11 4498046 missense probably benign 0.33
R5744:Mtmr3 UTSW 11 4487679 missense possibly damaging 0.47
R5847:Mtmr3 UTSW 11 4482925 missense probably damaging 1.00
R5933:Mtmr3 UTSW 11 4498951 missense probably benign
R6102:Mtmr3 UTSW 11 4487673 missense probably damaging 0.99
R6105:Mtmr3 UTSW 11 4485432 missense probably damaging 0.99
R6254:Mtmr3 UTSW 11 4497381 nonsense probably null
R6443:Mtmr3 UTSW 11 4487358 missense probably damaging 0.99
R6881:Mtmr3 UTSW 11 4489725 missense probably benign 0.33
R6941:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R6986:Mtmr3 UTSW 11 4489692 missense probably damaging 1.00
R7045:Mtmr3 UTSW 11 4498896 missense possibly damaging 0.94
T0975:Mtmr3 UTSW 11 4488441 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGTGGCCTCTTGCAAAATGTTC -3'
(R):5'- GGTGTAGACCATTTCGAGGGATGC -3'

Sequencing Primer
(F):5'- GGCTGCCACAGAAAGCTC -3'
(R):5'- gccccagttttgcataacc -3'
Posted On2013-07-30