Incidental Mutation 'R0655:Hivep1'
ID62512
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Namehuman immunodeficiency virus type I enhancer binding protein 1
SynonymsCryabp1, alphaA-CRYBP1
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R0655 (G1)
Quality Score194
Status Not validated
Chromosome13
Chromosomal Location42052021-42192537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42167585 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2123 (S2123P)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148]
Predicted Effect probably damaging
Transcript: ENSMUST00000060148
AA Change: S2123P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: S2123P

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000222854
AA Change: S32P
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42154649 missense probably benign 0.00
IGL00572:Hivep1 APN 13 42158871 missense probably benign 0.00
IGL00820:Hivep1 APN 13 42183818 missense probably benign 0.29
IGL00846:Hivep1 APN 13 42167616 nonsense probably null
IGL01068:Hivep1 APN 13 42159984 missense probably benign 0.00
IGL01431:Hivep1 APN 13 42158017 missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42159279 missense probably benign 0.18
IGL01833:Hivep1 APN 13 42154988 nonsense probably null
IGL02037:Hivep1 APN 13 42156077 missense probably benign 0.00
IGL02375:Hivep1 APN 13 42156449 missense probably benign 0.30
IGL02414:Hivep1 APN 13 42154909 missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42155654 missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42157311 missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42157685 missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42155936 missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42158904 missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42156128 missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42181671 missense
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0078:Hivep1 UTSW 13 42156041 missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42155435 missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42156153 missense probably benign
R0245:Hivep1 UTSW 13 42164290 missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42158379 missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42159756 missense probably benign 0.16
R0717:Hivep1 UTSW 13 42154946 missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42156962 missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42157521 missense probably benign 0.03
R1256:Hivep1 UTSW 13 42181831 missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42158043 missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42157140 missense probably benign 0.03
R1438:Hivep1 UTSW 13 42158120 missense probably benign 0.00
R1672:Hivep1 UTSW 13 42160284 missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42157931 missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42155646 missense probably benign 0.38
R1993:Hivep1 UTSW 13 42157493 missense probably benign 0.00
R2004:Hivep1 UTSW 13 42160149 missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42160124 missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42156318 missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42164393 critical splice donor site probably null
R2085:Hivep1 UTSW 13 42183750 missense probably benign 0.34
R3701:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3702:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3716:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3720:Hivep1 UTSW 13 42158601 missense probably benign 0.01
R3820:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R4379:Hivep1 UTSW 13 42155430 missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42155813 missense probably benign
R4587:Hivep1 UTSW 13 42156228 missense probably benign 0.00
R4604:Hivep1 UTSW 13 42159749 missense probably benign 0.08
R4686:Hivep1 UTSW 13 42155850 missense probably benign 0.00
R4725:Hivep1 UTSW 13 42163411 missense probably benign 0.19
R4924:Hivep1 UTSW 13 42158316 missense probably benign 0.20
R5009:Hivep1 UTSW 13 42158753 missense probably benign 0.06
R5320:Hivep1 UTSW 13 42159639 missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42164395 splice site probably null
R5498:Hivep1 UTSW 13 42123158 critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42158328 missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42156650 missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42160117 missense probably benign
R5635:Hivep1 UTSW 13 42160127 missense probably benign 0.16
R5636:Hivep1 UTSW 13 42163456 missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42156612 missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42157218 missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42160188 missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42184458 missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42158370 missense probably benign 0.01
R6247:Hivep1 UTSW 13 42157490 missense probably benign
R6343:Hivep1 UTSW 13 42159671 nonsense probably null
R6631:Hivep1 UTSW 13 42156480 missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42164284 missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42154727 missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42157081 missense probably benign 0.00
R6800:Hivep1 UTSW 13 42157376 missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42156507 missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42183452 missense probably benign 0.00
R6993:Hivep1 UTSW 13 42158714 missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42157338 missense probably benign 0.26
R7139:Hivep1 UTSW 13 42159954 missense probably benign 0.28
R7186:Hivep1 UTSW 13 42156338 missense probably benign 0.01
R7227:Hivep1 UTSW 13 42156911 missense probably benign 0.02
R7263:Hivep1 UTSW 13 42158192 missense possibly damaging 0.50
R7438:Hivep1 UTSW 13 42154911 missense probably damaging 0.99
X0060:Hivep1 UTSW 13 42154985 missense probably benign 0.07
X0067:Hivep1 UTSW 13 42156717 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCAGACGCACTCTGAAAGAGACAC -3'
(R):5'- GAGTTCTGGATGCCAAACTCTTCCC -3'

Sequencing Primer
(F):5'- GCCAGTTAGTACAAAGGTCATTGC -3'
(R):5'- CTCTTCCCTAGTAGGGTAAGATAAGC -3'
Posted On2013-07-30