Incidental Mutation 'R0655:Cd96'
ID62520
Institutional Source Beutler Lab
Gene Symbol Cd96
Ensembl Gene ENSMUSG00000022657
Gene NameCD96 antigen
Synonyms1700109I12Rik, Tactile
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0655 (G1)
Quality Score173
Status Not validated
Chromosome16
Chromosomal Location46035657-46120251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46099119 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 180 (K180E)
Ref Sequence ENSEMBL: ENSMUSP00000023336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023336]
Predicted Effect probably benign
Transcript: ENSMUST00000023336
AA Change: K180E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023336
Gene: ENSMUSG00000022657
AA Change: K180E

DomainStartEndE-ValueType
IG 30 137 1.63e-3 SMART
IG 145 247 1.12e-1 SMART
Blast:IG_like 257 357 3e-14 BLAST
low complexity region 434 448 N/A INTRINSIC
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 571 580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The protein may play a role in the adhesive interactions of activated T and NK cells during the late phase of the immune response. It may also function in antigen presentation. Alternative splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Cd96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cd96 APN 16 46071799 missense possibly damaging 0.85
IGL00588:Cd96 APN 16 46038554 missense probably benign 0.04
IGL00916:Cd96 APN 16 46041312 missense probably benign 0.07
IGL01080:Cd96 APN 16 46049693 missense possibly damaging 0.67
IGL01538:Cd96 APN 16 46109127 missense possibly damaging 0.67
IGL02350:Cd96 APN 16 46069776 splice site probably benign
IGL02357:Cd96 APN 16 46069776 splice site probably benign
IGL02892:Cd96 APN 16 46049797 critical splice acceptor site probably null
R0119:Cd96 UTSW 16 46038579 splice site probably benign
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0515:Cd96 UTSW 16 46063905 splice site probably benign
R0684:Cd96 UTSW 16 46117790 missense possibly damaging 0.96
R0838:Cd96 UTSW 16 46117926 missense probably damaging 1.00
R1531:Cd96 UTSW 16 46117806 missense probably benign 0.03
R1664:Cd96 UTSW 16 46118001 missense possibly damaging 0.95
R1791:Cd96 UTSW 16 46117999 nonsense probably null
R1840:Cd96 UTSW 16 46099092 missense probably benign 0.36
R1873:Cd96 UTSW 16 46117972 missense probably damaging 1.00
R2895:Cd96 UTSW 16 46117805 missense probably benign 0.43
R2906:Cd96 UTSW 16 46051487 missense possibly damaging 0.56
R4291:Cd96 UTSW 16 46071749 missense probably damaging 0.98
R5112:Cd96 UTSW 16 46098938 missense probably benign
R5261:Cd96 UTSW 16 46069653 missense probably benign 0.39
R5274:Cd96 UTSW 16 46069703 missense possibly damaging 0.78
R5934:Cd96 UTSW 16 46117903 missense probably benign 0.43
R6002:Cd96 UTSW 16 46117986 missense possibly damaging 0.61
R6758:Cd96 UTSW 16 46118004 missense possibly damaging 0.50
R6992:Cd96 UTSW 16 46049724 missense possibly damaging 0.65
R7239:Cd96 UTSW 16 46109114 missense probably damaging 1.00
R7308:Cd96 UTSW 16 46071734 critical splice donor site probably null
R7316:Cd96 UTSW 16 46069653 missense probably benign 0.39
R7355:Cd96 UTSW 16 46041292 missense possibly damaging 0.51
R7553:Cd96 UTSW 16 46052021 missense probably damaging 1.00
X0017:Cd96 UTSW 16 46049774 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAAGAGAATGTCCTGCCATCGTC -3'
(R):5'- TGCCATGAAAGCAAGACCCGTTTAG -3'

Sequencing Primer
(F):5'- CCATCGTCTTGGATTTGGACTG -3'
(R):5'- aagtccctgttgctcttcc -3'
Posted On2013-07-30