Incidental Mutation 'R0655:Safb'
ID62525
Institutional Source Beutler Lab
Gene Symbol Safb
Ensembl Gene ENSMUSG00000071054
Gene Namescaffold attachment factor B
Synonyms3110021E02Rik, SAFB1, 5330423C17Rik
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R0655 (G1)
Quality Score153
Status Not validated
Chromosome17
Chromosomal Location56584825-56606294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56597803 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 209 (S209T)
Ref Sequence ENSEMBL: ENSMUSP00000092849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095224] [ENSMUST00000182533] [ENSMUST00000182800]
Predicted Effect probably benign
Transcript: ENSMUST00000095224
AA Change: S209T

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092849
Gene: ENSMUSG00000071054
AA Change: S209T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182378
Predicted Effect unknown
Transcript: ENSMUST00000182533
AA Change: S209T
SMART Domains Protein: ENSMUSP00000138277
Gene: ENSMUSG00000071054
AA Change: S209T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182800
Predicted Effect unknown
Transcript: ENSMUST00000182951
AA Change: S126T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183041
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein which has high specificity for scaffold or matrix attachment region DNA elements (S/MAR DNA). This protein is thought to be involved in attaching the base of chromatin loops to the nuclear matrix but there is conflicting evidence as to whether this protein is a component of chromatin or a nuclear matrix protein. Scaffold attachment factors are a specific subset of nuclear matrix proteins (NMP) that specifically bind to S/MAR. The encoded protein is thought to serve as a molecular base to assemble a 'transcriptosome complex' in the vicinity of actively transcribed genes. It is involved in the regulation of heat shock protein 27 transcription, can act as an estrogen receptor co-repressor and is a candidate for breast tumorigenesis. This gene is arranged head-to-head with a similar gene whose product has the same functions. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and neonatal lethality, neonatal cyanosis, impaired embryonic hematopoiesis, male sterility, azoospermia, reduced female fertility, impaired transport of embryos through the oviduct, reduced embryonic growth, testicular degeneration and ovarian atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Esf1 T A 2: 140,148,879 T562S probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Safb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Safb APN 17 56602974 unclassified probably benign
IGL02391:Safb APN 17 56600813 splice site probably benign
IGL03145:Safb APN 17 56605287 missense probably damaging 1.00
R0245:Safb UTSW 17 56606025 missense probably damaging 1.00
R0464:Safb UTSW 17 56606025 missense probably damaging 1.00
R0468:Safb UTSW 17 56606025 missense probably damaging 1.00
R0479:Safb UTSW 17 56606025 missense probably damaging 1.00
R0496:Safb UTSW 17 56605630 missense probably benign 0.05
R0639:Safb UTSW 17 56601092 utr 3 prime probably benign
R1109:Safb UTSW 17 56601228 splice site probably benign
R1941:Safb UTSW 17 56598992 intron probably benign
R1969:Safb UTSW 17 56605821 missense probably benign 0.32
R1971:Safb UTSW 17 56605821 missense probably benign 0.32
R4010:Safb UTSW 17 56603765 unclassified probably benign
R4132:Safb UTSW 17 56600848 utr 3 prime probably benign
R5429:Safb UTSW 17 56588822 missense probably benign 0.15
R5681:Safb UTSW 17 56599000 intron probably benign
R5900:Safb UTSW 17 56600349 missense unknown
R6077:Safb UTSW 17 56602956 unclassified probably benign
R6173:Safb UTSW 17 56597798 missense probably damaging 1.00
R6367:Safb UTSW 17 56593845 unclassified probably benign
R6735:Safb UTSW 17 56585169 unclassified probably benign
R6736:Safb UTSW 17 56606023 missense possibly damaging 0.46
X0065:Safb UTSW 17 56603798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGCTGTGCTCCTGATTTCAAG -3'
(R):5'- TTCTGTTTAAAGGCAGGCGGCGAC -3'

Sequencing Primer
(F):5'- GTTCAGTCCTGAGGGAACTACAC -3'
(R):5'- ATGCCGCACGATTGCTG -3'
Posted On2013-07-30