Incidental Mutation 'R0656:Tmem79'
ID62540
Institutional Source Beutler Lab
Gene Symbol Tmem79
Ensembl Gene ENSMUSG00000001420
Gene Nametransmembrane protein 79
Synonymsmattrin, 2310074C17Rik, ma, 2310042N02Rik, Matt
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0656 (G1)
Quality Score92
Status Validated
Chromosome3
Chromosomal Location88328655-88336148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88332934 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000103177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451] [ENSMUST00000001454] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000154381] [ENSMUST00000176425] [ENSMUST00000176519] [ENSMUST00000177005] [ENSMUST00000193872]
Predicted Effect probably benign
Transcript: ENSMUST00000001451
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001454
SMART Domains Protein: ENSMUSP00000001454
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 130 2.7e-26 PFAM
Pfam:NCU-G1 124 333 4.8e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000001456
AA Change: T236A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420
AA Change: T236A

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107552
AA Change: T236A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420
AA Change: T236A

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107553
AA Change: T236A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420
AA Change: T236A

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140039
Predicted Effect probably benign
Transcript: ENSMUST00000154381
SMART Domains Protein: ENSMUSP00000134809
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
Pfam:NCU-G1 2 72 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176425
SMART Domains Protein: ENSMUSP00000135575
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 37 314 3.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176519
SMART Domains Protein: ENSMUSP00000135263
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 125 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177005
SMART Domains Protein: ENSMUSP00000135398
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 54 397 1.1e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193646
Predicted Effect probably benign
Transcript: ENSMUST00000193872
SMART Domains Protein: ENSMUSP00000141830
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194942
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal coat/hair pigmentation, abnormal zigzag hair morphology, and a more sparse and shiny coat than wild-type controls. Some adults display a mild irritation around the eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Cgn T C 3: 94,774,894 probably benign Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gcn1l1 C T 5: 115,589,303 T714M probably benign Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mgat4c T C 10: 102,388,591 M222T probably damaging Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Myo1e A T 9: 70,367,674 Q703L probably damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Olfr1294 T C 2: 111,537,627 I221V probably damaging Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Timm21 T C 18: 84,949,201 H150R probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Vmn1r8 A T 6: 57,036,588 Q208L probably benign Het
Other mutations in Tmem79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Tmem79 APN 3 88332576 missense possibly damaging 0.82
IGL01883:Tmem79 APN 3 88329838 missense probably damaging 1.00
IGL02680:Tmem79 APN 3 88332963 missense probably damaging 1.00
snickerdoodle UTSW 3 88332563 missense probably damaging 1.00
R0239:Tmem79 UTSW 3 88333321 missense probably benign
R0239:Tmem79 UTSW 3 88333321 missense probably benign
R4663:Tmem79 UTSW 3 88333444 missense probably damaging 0.98
R5168:Tmem79 UTSW 3 88333344 missense probably damaging 0.99
R5583:Tmem79 UTSW 3 88332563 missense probably damaging 1.00
R7305:Tmem79 UTSW 3 88333411 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGGATACCCTGAGTGGTTCCAG -3'
(R):5'- GATCTACAGTGCATCGAGCGGAAG -3'

Sequencing Primer
(F):5'- CTGAGTGGTTCCAGCAGAATG -3'
(R):5'- GAATTTCCTGCCAGCTCGAC -3'
Posted On2013-07-30