Incidental Mutation 'R0710:Poli'
ID62712
Institutional Source Beutler Lab
Gene Symbol Poli
Ensembl Gene ENSMUSG00000038425
Gene Namepolymerase (DNA directed), iota
SynonymsRad30b
MMRRC Submission 038893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0710 (G1)
Quality Score158
Status Not validated
Chromosome18
Chromosomal Location70508680-70530620 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 70522890 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043286] [ENSMUST00000121674] [ENSMUST00000159389] [ENSMUST00000160713] [ENSMUST00000161542]
Predicted Effect probably null
Transcript: ENSMUST00000043286
SMART Domains Protein: ENSMUSP00000039869
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Predicted Effect probably null
Transcript: ENSMUST00000121674
SMART Domains Protein: ENSMUSP00000112563
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:IMS 53 231 1e-47 PFAM
Pfam:IMS_HHH 243 275 1.5e-9 PFAM
Pfam:IMS_C 312 441 2.5e-14 PFAM
PDB:2KWV|A 507 552 8e-23 PDB
low complexity region 595 609 N/A INTRINSIC
PDB:3AI4|A 686 737 5e-26 PDB
Predicted Effect probably null
Transcript: ENSMUST00000159389
SMART Domains Protein: ENSMUSP00000123964
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 145 1.8e-29 PFAM
Pfam:IMS_HHH 157 189 1.7e-9 PFAM
Pfam:IMS_C 224 356 2.4e-12 PFAM
PDB:2KWV|A 421 466 7e-23 PDB
low complexity region 509 523 N/A INTRINSIC
PDB:3AI4|A 600 651 3e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160713
SMART Domains Protein: ENSMUSP00000125467
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 127 5.9e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161542
SMART Domains Protein: ENSMUSP00000124877
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show normal somatic hypermutation of immunoglobulin variable genes and no significant increase in UV-induced epithelial skin tumor formation relative to controls; in contrast, formation of mesenchymal tumors by chronic UV irradiation is enhanced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Celsr2 A G 3: 108,412,712 V928A probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Farp1 C T 14: 121,237,143 T256M probably damaging Het
Fbxl3 G T 14: 103,089,315 H162Q probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gpatch8 A G 11: 102,481,933 S260P unknown Het
Hectd4 G A 5: 121,336,628 V2771I probably benign Het
Hgf C A 5: 16,566,763 C129* probably null Het
Hmg20a G A 9: 56,474,670 D77N possibly damaging Het
Iqch A T 9: 63,525,136 S287T probably benign Het
Kcnj11 T C 7: 46,099,125 Y258C probably benign Het
Kif1c A G 11: 70,726,497 T874A probably benign Het
Mlc1 G T 15: 88,977,864 Q50K possibly damaging Het
Mtor T C 4: 148,464,391 S544P possibly damaging Het
Mypop A T 7: 19,000,560 probably null Het
Rasa3 C A 8: 13,583,830 V478L probably damaging Het
Scn3a A T 2: 65,469,046 M1372K probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tnpo3 T C 6: 29,586,075 D172G possibly damaging Het
Tulp2 T A 7: 45,520,808 V301D possibly damaging Het
Ubr2 G A 17: 46,938,681 R1582W probably damaging Het
Ubr3 T C 2: 69,952,837 S706P probably damaging Het
Vmn1r171 C A 7: 23,633,001 S205Y probably damaging Het
Wnk4 G A 11: 101,274,106 A754T probably benign Het
Zfp282 C T 6: 47,880,384 R184W probably damaging Het
Other mutations in Poli
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Poli APN 18 70525490 missense probably damaging 1.00
IGL01506:Poli APN 18 70509731 missense probably benign
IGL01958:Poli APN 18 70526586 missense possibly damaging 0.46
IGL02375:Poli APN 18 70523292 missense probably damaging 1.00
IGL02385:Poli APN 18 70526574 missense possibly damaging 0.93
IGL02480:Poli APN 18 70525406 missense probably benign 0.04
R0113:Poli UTSW 18 70528758 missense probably damaging 1.00
R0184:Poli UTSW 18 70522731 missense probably damaging 1.00
R0348:Poli UTSW 18 70523381 missense probably benign 0.00
R1004:Poli UTSW 18 70525438 missense probably benign 0.31
R1264:Poli UTSW 18 70517503 missense probably benign 0.05
R1660:Poli UTSW 18 70509464 missense probably damaging 0.99
R1992:Poli UTSW 18 70508987 missense probably damaging 0.98
R2915:Poli UTSW 18 70522700 critical splice donor site probably null
R4531:Poli UTSW 18 70517477 missense probably benign 0.41
R4816:Poli UTSW 18 70522751 missense probably damaging 1.00
R5393:Poli UTSW 18 70517428 nonsense probably null
R5404:Poli UTSW 18 70509432 missense probably benign 0.15
R5559:Poli UTSW 18 70509285 missense probably benign 0.02
R5957:Poli UTSW 18 70517440 missense probably benign
R6045:Poli UTSW 18 70517469 missense possibly damaging 0.75
R6385:Poli UTSW 18 70530001 start gained probably benign
R6807:Poli UTSW 18 70530151 intron probably null
R7024:Poli UTSW 18 70516849 missense possibly damaging 0.68
R7067:Poli UTSW 18 70509417 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGGAGACTTGTCCTCTCCAAAAC -3'
(R):5'- TGCGGGAAGCCATGTATAATCAGC -3'

Sequencing Primer
(F):5'- TCTCCAAAACTGAGCTGCTGG -3'
(R):5'- AGCAGACGGTCTTACTACCTG -3'
Posted On2013-07-30