Incidental Mutation 'R0711:1110002E22Rik'
List |< first << previous [record 92 of 386652] next >> last >|
ID62722
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 038894-MU
Accession Numbers
Stock #R0711 (G1)
Quality Score130
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138068225 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1058 (D1058E)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: D1058E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: D1058E

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 100% (91/91)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015E13Rik C T 1: 170,312,034 Q201* probably null Het
4933405L10Rik A T 8: 105,708,931 N74Y probably damaging Het
AC158220.1 T C 7: 27,990,273 N170S probably benign Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Ankrd6 G A 4: 32,815,326 A426V probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Asxl3 G T 18: 22,524,451 M1839I probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Celf2 A G 2: 6,721,415 probably null Het
Chid1 C T 7: 141,496,677 V325I probably benign Het
Cnn3 T A 3: 121,449,984 D31E probably benign Het
Col12a1 G A 9: 79,652,035 P1857L probably damaging Het
Cpeb1 T A 7: 81,351,870 R430W probably benign Het
CT573017.1 A G 17: 68,842,254 T611A probably damaging Het
Daw1 T C 1: 83,191,338 probably benign Het
Dcaf13 A G 15: 39,138,089 Y264C probably damaging Het
Dnah6 T C 6: 73,087,602 I2666V probably damaging Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dock10 A T 1: 80,523,975 F1846I probably damaging Het
Efhd2 C T 4: 141,859,872 A200T probably damaging Het
Epb4.1l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y351H possibly damaging Het
Gkn2 T C 6: 87,373,419 probably benign Het
Golgb1 A T 16: 36,918,790 Q2538L probably damaging Het
Gzme A T 14: 56,117,739 M245K probably damaging Het
Iars2 A T 1: 185,322,388 probably benign Het
Icosl T A 10: 78,073,941 V240D probably damaging Het
Igsf3 T C 3: 101,427,393 M262T probably benign Het
Ing3 G T 6: 21,971,237 E347* probably null Het
Kat2a A T 11: 100,706,471 V626E probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Mdfi A T 17: 47,832,930 probably benign Het
Med13 A G 11: 86,301,353 probably benign Het
Mllt4 C T 17: 13,852,436 P896S probably damaging Het
Msh6 C T 17: 87,986,684 R956C probably damaging Het
Myo15b A G 11: 115,883,838 E1395G probably damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Olfr1193 A G 2: 88,678,674 D273G probably damaging Het
Olfr632 G A 7: 103,937,817 A146T probably benign Het
Olfr834 T A 9: 18,988,151 N54K probably benign Het
Pde8b C G 13: 95,107,817 S123T possibly damaging Het
Pias4 G T 10: 81,157,530 probably benign Het
Prkca A G 11: 107,981,654 Y427H probably benign Het
Psg25 G A 7: 18,529,560 Q113* probably null Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Scrib A G 15: 76,066,907 probably benign Het
Sdk2 A G 11: 113,903,144 probably benign Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Serpinb9f T A 13: 33,327,921 W136R probably damaging Het
Skint10 C A 4: 112,715,905 probably benign Het
Slc25a13 T C 6: 6,117,128 T196A probably damaging Het
Slc26a5 T C 5: 21,847,232 H33R probably damaging Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Slitrk6 A T 14: 110,749,819 Y819N probably damaging Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Taf6l A G 19: 8,778,517 F282L probably benign Het
Tmco3 T A 8: 13,292,039 N104K probably damaging Het
Tmem202 T G 9: 59,525,372 Y24S probably damaging Het
Tpp1 A G 7: 105,749,419 L230P probably damaging Het
Trim56 C T 5: 137,112,992 E557K probably benign Het
Trrap C T 5: 144,853,499 L3590F probably damaging Het
Ttc37 C T 13: 76,182,891 P1480L probably damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Vcp G C 4: 42,986,201 A297G probably benign Het
Vwf T A 6: 125,626,271 H864Q possibly damaging Het
Wdr64 T C 1: 175,772,185 I526T probably benign Het
Zfp72 G A 13: 74,376,425 probably benign Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion unknown
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTCTACCATCATGTCTCGCC -3'
(R):5'- CAAGAGTCTACCGCCATTGCTCAC -3'

Sequencing Primer
(F):5'- TGTTCCCAACATCCAGCAG -3'
(R):5'- CTGGCACATAATCACCATAGGGG -3'
Posted OnJul 30, 2013