Incidental Mutation 'R0711:Ing3'
ID62731
Institutional Source Beutler Lab
Gene Symbol Ing3
Ensembl Gene ENSMUSG00000029670
Gene Nameinhibitor of growth family, member 3
Synonyms1300013A07Rik, P47ING3
MMRRC Submission 038894-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0711 (G1)
Quality Score115
Status Validated
Chromosome6
Chromosomal Location21949571-21976038 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 21971237 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 336 (E336*)
Ref Sequence ENSEMBL: ENSMUSP00000111047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031680] [ENSMUST00000115389] [ENSMUST00000136200] [ENSMUST00000149728] [ENSMUST00000151473] [ENSMUST00000152877]
Predicted Effect probably null
Transcript: ENSMUST00000031680
AA Change: E347*
SMART Domains Protein: ENSMUSP00000031680
Gene: ENSMUSG00000029670
AA Change: E347*

DomainStartEndE-ValueType
Pfam:ING 3 104 2.7e-31 PFAM
low complexity region 214 239 N/A INTRINSIC
low complexity region 308 345 N/A INTRINSIC
PHD 365 410 4e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115389
AA Change: E336*
SMART Domains Protein: ENSMUSP00000111047
Gene: ENSMUSG00000029670
AA Change: E336*

DomainStartEndE-ValueType
Pfam:ING 2 104 1.5e-33 PFAM
low complexity region 203 228 N/A INTRINSIC
low complexity region 297 334 N/A INTRINSIC
PHD 354 399 6.39e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136200
SMART Domains Protein: ENSMUSP00000138656
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 41 1.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144534
Predicted Effect probably benign
Transcript: ENSMUST00000149728
SMART Domains Protein: ENSMUSP00000145391
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 1 89 6.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151473
SMART Domains Protein: ENSMUSP00000120651
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 80 1.9e-19 PFAM
low complexity region 190 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152877
SMART Domains Protein: ENSMUSP00000138244
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 89 1.5e-27 PFAM
Meta Mutation Damage Score 0.64 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,068,225 D1058E probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Afdn C T 17: 13,852,436 P874S probably damaging Het
Ankrd6 G A 4: 32,815,326 A391V probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Asxl3 G T 18: 22,524,451 M1839I probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Celf2 A G 2: 6,721,415 probably null Het
Chid1 C T 7: 141,496,677 V325I probably benign Het
Cnn3 T A 3: 121,449,984 D31E probably benign Het
Col12a1 G A 9: 79,652,035 P1857L probably damaging Het
Cpeb1 T A 7: 81,351,870 R430W probably benign Het
Daw1 T C 1: 83,191,338 probably benign Het
Dcaf13 A G 15: 39,138,089 Y264C probably damaging Het
Dnah6 T C 6: 73,087,602 I2666V probably damaging Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dock10 A T 1: 80,523,975 F1833I probably damaging Het
Efhd2 C T 4: 141,859,872 A200T probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Gkn2 T C 6: 87,373,419 probably benign Het
Golgb1 A T 16: 36,918,790 Q2497L probably damaging Het
Gzme A T 14: 56,117,739 M245K probably damaging Het
Iars2 A T 1: 185,322,388 probably benign Het
Icosl T A 10: 78,073,941 V240D probably damaging Het
Igsf3 T C 3: 101,427,393 M262T probably benign Het
Kat2a A T 11: 100,706,471 V625E probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Mdfi A T 17: 47,832,930 probably benign Het
Med13 A G 11: 86,301,353 probably benign Het
Msh6 C T 17: 87,986,684 R956C probably damaging Het
Myo15b A G 11: 115,883,838 E670G probably damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Olfr1193 A G 2: 88,678,674 D266G probably damaging Het
Olfr632 G A 7: 103,937,817 A146T probably benign Het
Olfr834 T A 9: 18,988,151 N54K probably benign Het
Pde8b C G 13: 95,107,817 S143T possibly damaging Het
Pias4 G T 10: 81,157,530 probably benign Het
Prkca A G 11: 107,981,654 Y427H probably benign Het
Psg25 G A 7: 18,529,560 Q113* probably null Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Scrib A G 15: 76,066,907 probably benign Het
Sdk2 A G 11: 113,903,144 probably benign Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Serpinb9f T A 13: 33,327,921 W136R probably damaging Het
Skint10 C A 4: 112,715,905 probably benign Het
Slc25a13 T C 6: 6,117,128 T196A probably damaging Het
Slc26a5 T C 5: 21,847,232 H33R probably damaging Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Slitrk6 A T 14: 110,749,819 Y819N probably damaging Het
Spata46 C T 1: 170,312,034 Q201* probably null Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Taf6l A G 19: 8,778,517 F256L probably benign Het
Tmco3 T A 8: 13,292,039 N104K probably damaging Het
Tmem200c A G 17: 68,842,254 T611A probably damaging Het
Tmem202 T G 9: 59,525,372 Y24S probably damaging Het
Tpp1 A G 7: 105,749,419 L230P probably damaging Het
Trim56 C T 5: 137,112,992 E557K probably benign Het
Trrap C T 5: 144,853,499 L3590F probably damaging Het
Ttc37 C T 13: 76,182,891 P1480L probably damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Vcp G C 4: 42,986,201 A297G probably benign Het
Vwf T A 6: 125,626,271 H861Q probably benign Het
Wdr64 T C 1: 175,772,185 I536T probably benign Het
Zfp72 G A 13: 74,376,425 probably benign Het
Zfp850 T C 7: 27,990,273 N170S probably benign Het
Other mutations in Ing3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Ing3 APN 6 21968880 splice site probably benign
IGL02330:Ing3 APN 6 21952121 missense probably benign 0.00
IGL02668:Ing3 APN 6 21950059 missense probably damaging 0.98
IGL02897:Ing3 APN 6 21969326 missense probably benign 0.14
IGL03065:Ing3 APN 6 21971222 missense probably benign
R0076:Ing3 UTSW 6 21952171 missense probably benign
R0513:Ing3 UTSW 6 21970035 missense probably damaging 0.98
R2369:Ing3 UTSW 6 21950091 missense probably damaging 0.98
R4660:Ing3 UTSW 6 21973711 utr 3 prime probably benign
R4672:Ing3 UTSW 6 21965730 splice site probably null
R5557:Ing3 UTSW 6 21968909 missense possibly damaging 0.95
R5682:Ing3 UTSW 6 21968950 missense probably damaging 0.98
R5773:Ing3 UTSW 6 21971835 missense probably damaging 1.00
R5774:Ing3 UTSW 6 21967689 missense probably benign
R5914:Ing3 UTSW 6 21968905 missense probably benign 0.18
R5976:Ing3 UTSW 6 21971174 missense probably benign 0.09
R6265:Ing3 UTSW 6 21953814 missense probably damaging 0.99
R7239:Ing3 UTSW 6 21952194 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAACAAATGCAGCTAATCTGCCTG -3'
(R):5'- GCCTTTAAACTCACAGACTGGCCTTAC -3'

Sequencing Primer
(F):5'- GCTAATCTGCCTGTAATTTTTTCAG -3'
(R):5'- GGCCTTACAGGTAGCTAGTCAAC -3'
Posted On2013-07-30