Incidental Mutation 'R0711:Olfr632'
ID62738
Institutional Source Beutler Lab
Gene Symbol Olfr632
Ensembl Gene ENSMUSG00000073938
Gene Nameolfactory receptor 632
SynonymsGA_x6K02T2PBJ9-6671256-6672209, MOR2-1
MMRRC Submission 038894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0711 (G1)
Quality Score168
Status Validated
Chromosome7
Chromosomal Location103934347-103940579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103937817 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 146 (A146T)
Ref Sequence ENSEMBL: ENSMUSP00000149598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098189] [ENSMUST00000214711]
Predicted Effect probably benign
Transcript: ENSMUST00000098189
AA Change: A146T

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095791
Gene: ENSMUSG00000073938
AA Change: A146T

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 2.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 39 232 7.5e-11 PFAM
Pfam:7tm_1 45 296 1.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214509
Predicted Effect probably benign
Transcript: ENSMUST00000214711
AA Change: A146T

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1576 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,068,225 D1058E probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Afdn C T 17: 13,852,436 P874S probably damaging Het
Ankrd6 G A 4: 32,815,326 A391V probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Asxl3 G T 18: 22,524,451 M1839I probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Celf2 A G 2: 6,721,415 probably null Het
Chid1 C T 7: 141,496,677 V325I probably benign Het
Cnn3 T A 3: 121,449,984 D31E probably benign Het
Col12a1 G A 9: 79,652,035 P1857L probably damaging Het
Cpeb1 T A 7: 81,351,870 R430W probably benign Het
Daw1 T C 1: 83,191,338 probably benign Het
Dcaf13 A G 15: 39,138,089 Y264C probably damaging Het
Dnah6 T C 6: 73,087,602 I2666V probably damaging Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dock10 A T 1: 80,523,975 F1833I probably damaging Het
Efhd2 C T 4: 141,859,872 A200T probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Gkn2 T C 6: 87,373,419 probably benign Het
Golgb1 A T 16: 36,918,790 Q2497L probably damaging Het
Gzme A T 14: 56,117,739 M245K probably damaging Het
Iars2 A T 1: 185,322,388 probably benign Het
Icosl T A 10: 78,073,941 V240D probably damaging Het
Igsf3 T C 3: 101,427,393 M262T probably benign Het
Ing3 G T 6: 21,971,237 E336* probably null Het
Kat2a A T 11: 100,706,471 V625E probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Mdfi A T 17: 47,832,930 probably benign Het
Med13 A G 11: 86,301,353 probably benign Het
Msh6 C T 17: 87,986,684 R956C probably damaging Het
Myo15b A G 11: 115,883,838 E670G probably damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Olfr1193 A G 2: 88,678,674 D266G probably damaging Het
Olfr834 T A 9: 18,988,151 N54K probably benign Het
Pde8b C G 13: 95,107,817 S143T possibly damaging Het
Pias4 G T 10: 81,157,530 probably benign Het
Prkca A G 11: 107,981,654 Y427H probably benign Het
Psg25 G A 7: 18,529,560 Q113* probably null Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Scrib A G 15: 76,066,907 probably benign Het
Sdk2 A G 11: 113,903,144 probably benign Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Serpinb9f T A 13: 33,327,921 W136R probably damaging Het
Skint10 C A 4: 112,715,905 probably benign Het
Slc25a13 T C 6: 6,117,128 T196A probably damaging Het
Slc26a5 T C 5: 21,847,232 H33R probably damaging Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Slitrk6 A T 14: 110,749,819 Y819N probably damaging Het
Spata46 C T 1: 170,312,034 Q201* probably null Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Taf6l A G 19: 8,778,517 F256L probably benign Het
Tmco3 T A 8: 13,292,039 N104K probably damaging Het
Tmem200c A G 17: 68,842,254 T611A probably damaging Het
Tmem202 T G 9: 59,525,372 Y24S probably damaging Het
Tpp1 A G 7: 105,749,419 L230P probably damaging Het
Trim56 C T 5: 137,112,992 E557K probably benign Het
Trrap C T 5: 144,853,499 L3590F probably damaging Het
Ttc37 C T 13: 76,182,891 P1480L probably damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Vcp G C 4: 42,986,201 A297G probably benign Het
Vwf T A 6: 125,626,271 H861Q probably benign Het
Wdr64 T C 1: 175,772,185 I536T probably benign Het
Zfp72 G A 13: 74,376,425 probably benign Het
Zfp850 T C 7: 27,990,273 N170S probably benign Het
Other mutations in Olfr632
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr632 APN 7 103937575 missense possibly damaging 0.88
IGL01817:Olfr632 APN 7 103937823 missense probably benign 0.01
IGL02303:Olfr632 APN 7 103937563 missense possibly damaging 0.62
IGL03392:Olfr632 APN 7 103938025 missense probably benign 0.01
R0092:Olfr632 UTSW 7 103937727 missense probably damaging 1.00
R0492:Olfr632 UTSW 7 103937764 missense probably benign 0.05
R2893:Olfr632 UTSW 7 103938182 missense probably damaging 1.00
R3911:Olfr632 UTSW 7 103937409 missense possibly damaging 0.94
R4825:Olfr632 UTSW 7 103937503 missense probably benign 0.02
R6106:Olfr632 UTSW 7 103938193 missense probably benign 0.05
R6254:Olfr632 UTSW 7 103937534 missense probably benign 0.07
R6383:Olfr632 UTSW 7 103937823 missense probably benign 0.01
R6821:Olfr632 UTSW 7 103937586 missense probably benign 0.07
R6890:Olfr632 UTSW 7 103937859 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATGTCAACGCTGCCTTCTGTGCTG -3'
(R):5'- AGACACTGTGCCCATTAGGATGTGC -3'

Sequencing Primer
(F):5'- CCTTCTGTGCTGGGGGTG -3'
(R):5'- TGATGCACAGTCCATAGAGTCTG -3'
Posted On2013-07-30