Incidental Mutation 'R0712:Chrna5'
ID 62784
Institutional Source Beutler Lab
Gene Symbol Chrna5
Ensembl Gene ENSMUSG00000035594
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms Acra-5, Acra5
MMRRC Submission 038895-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R0712 (G1)
Quality Score 218
Status Not validated
Chromosome 9
Chromosomal Location 54888164-54915063 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 54911647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Isoleucine at position 45 (K45I)
Ref Sequence ENSEMBL: ENSMUSP00000149366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]
AlphaFold Q2MKA5
Predicted Effect probably benign
Transcript: ENSMUST00000093844
AA Change: K120I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: K120I

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 18 221 4.9e-72 PFAM
Pfam:Neur_chan_memb 228 352 1.9e-51 PFAM
Pfam:Neur_chan_memb 338 417 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213960
AA Change: K149I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217408
AA Change: K45I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd1 G A X: 72,774,471 (GRCm39) V489M possibly damaging Het
Anln A T 9: 22,291,594 (GRCm39) V78E probably benign Het
Atp2b4 T C 1: 133,658,216 (GRCm39) K565E probably damaging Het
Cap2 T C 13: 46,768,837 (GRCm39) probably null Het
Cdh22 A G 2: 165,012,576 (GRCm39) Y170H probably damaging Het
Dnaaf4 G T 9: 72,867,939 (GRCm39) G67* probably null Het
Hdac8 T A X: 101,543,524 (GRCm39) M67L probably benign Het
Lama1 A G 17: 68,086,037 (GRCm39) probably null Het
Lrba T A 3: 86,205,297 (GRCm39) Y380* probably null Het
Mastl A G 2: 23,041,005 (GRCm39) Y106H probably damaging Het
Obscn T C 11: 58,940,271 (GRCm39) E5210G possibly damaging Het
Or12d2 T A 17: 37,624,975 (GRCm39) H100L probably damaging Het
Or4d5 A G 9: 40,012,726 (GRCm39) V20A probably benign Het
Pcgf2 T C 11: 97,581,830 (GRCm39) Y21C probably damaging Het
Penk T C 4: 4,134,257 (GRCm39) E130G probably benign Het
Rnmt G A 18: 68,440,859 (GRCm39) probably null Het
Stk11ip T A 1: 75,504,091 (GRCm39) L277Q probably damaging Het
Synpo2l A G 14: 20,711,907 (GRCm39) S238P probably damaging Het
Tex264 A C 9: 106,536,431 (GRCm39) L242R possibly damaging Het
Ubald2 T C 11: 116,325,401 (GRCm39) F46S probably damaging Het
Zfp692 T C 11: 58,205,140 (GRCm39) V463A probably benign Het
Other mutations in Chrna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Chrna5 APN 9 54,911,683 (GRCm39) missense possibly damaging 0.61
IGL01503:Chrna5 APN 9 54,905,455 (GRCm39) intron probably benign
IGL01617:Chrna5 APN 9 54,912,297 (GRCm39) missense probably damaging 0.98
IGL01935:Chrna5 APN 9 54,912,127 (GRCm39) missense probably benign 0.01
IGL02613:Chrna5 APN 9 54,913,705 (GRCm39) missense probably damaging 0.99
IGL03248:Chrna5 APN 9 54,911,923 (GRCm39) missense probably damaging 1.00
IGL03412:Chrna5 APN 9 54,911,719 (GRCm39) missense probably damaging 1.00
R1619:Chrna5 UTSW 9 54,911,649 (GRCm39) missense probably benign 0.00
R1698:Chrna5 UTSW 9 54,911,926 (GRCm39) missense probably damaging 1.00
R1789:Chrna5 UTSW 9 54,911,935 (GRCm39) missense possibly damaging 0.94
R1800:Chrna5 UTSW 9 54,912,159 (GRCm39) missense probably damaging 0.99
R4028:Chrna5 UTSW 9 54,905,370 (GRCm39) missense probably damaging 1.00
R4030:Chrna5 UTSW 9 54,905,370 (GRCm39) missense probably damaging 1.00
R4031:Chrna5 UTSW 9 54,905,370 (GRCm39) missense probably damaging 1.00
R4201:Chrna5 UTSW 9 54,905,359 (GRCm39) missense probably benign 0.00
R4792:Chrna5 UTSW 9 54,911,985 (GRCm39) missense probably damaging 1.00
R5196:Chrna5 UTSW 9 54,913,803 (GRCm39) missense possibly damaging 0.91
R5718:Chrna5 UTSW 9 54,905,389 (GRCm39) missense probably benign 0.00
R5779:Chrna5 UTSW 9 54,905,388 (GRCm39) missense probably benign 0.35
R6254:Chrna5 UTSW 9 54,913,740 (GRCm39) missense probably benign 0.00
R6492:Chrna5 UTSW 9 54,905,347 (GRCm39) missense probably benign 0.11
R6887:Chrna5 UTSW 9 54,912,417 (GRCm39) missense probably benign 0.00
R6986:Chrna5 UTSW 9 54,913,741 (GRCm39) missense possibly damaging 0.83
R7056:Chrna5 UTSW 9 54,888,985 (GRCm39) intron probably benign
R7222:Chrna5 UTSW 9 54,905,347 (GRCm39) missense probably benign 0.11
R7384:Chrna5 UTSW 9 54,912,117 (GRCm39) missense probably damaging 1.00
R7572:Chrna5 UTSW 9 54,913,749 (GRCm39) missense probably damaging 1.00
R7653:Chrna5 UTSW 9 54,909,718 (GRCm39) missense probably benign
R7846:Chrna5 UTSW 9 54,912,391 (GRCm39) missense probably benign 0.38
R8808:Chrna5 UTSW 9 54,905,348 (GRCm39) missense probably benign 0.20
R8901:Chrna5 UTSW 9 54,911,737 (GRCm39) missense probably damaging 1.00
R9303:Chrna5 UTSW 9 54,912,156 (GRCm39) missense probably benign 0.16
R9716:Chrna5 UTSW 9 54,911,919 (GRCm39) missense probably benign 0.00
Z1176:Chrna5 UTSW 9 54,911,766 (GRCm39) missense probably damaging 1.00
Z1177:Chrna5 UTSW 9 54,912,240 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGGCATTGGGGCAGACAGTAATTTC -3'
(R):5'- AGGCAGCCGTTTGATCACGAAG -3'

Sequencing Primer
(F):5'- GGGCAGACAGTAATTTCAAACTC -3'
(R):5'- CCGTTTGATCACGAAGGAGTAG -3'
Posted On 2013-07-30