Incidental Mutation 'R0712:Hdac8'
ID 62801
Institutional Source Beutler Lab
Gene Symbol Hdac8
Ensembl Gene ENSMUSG00000067567
Gene Name histone deacetylase 8
Synonyms 2610007D20Rik
MMRRC Submission 038895-MU
Accession Numbers
Essential gene? Not available question?
Stock # R0712 (G1)
Quality Score 225
Status Not validated
Chromosome X
Chromosomal Location 101328245-101548965 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101543524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 67 (M67L)
Ref Sequence ENSEMBL: ENSMUSP00000085226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087916] [ENSMUST00000154872]
AlphaFold Q8VH37
Predicted Effect probably benign
Transcript: ENSMUST00000087916
AA Change: M67L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000085226
Gene: ENSMUSG00000067567
AA Change: M67L

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 20 323 1.3e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154024
Predicted Effect probably benign
Transcript: ENSMUST00000154872
SMART Domains Protein: ENSMUSP00000138805
Gene: ENSMUSG00000067567

DomainStartEndE-ValueType
PDB:3EWF|D 1 56 2e-27 PDB
SCOP:d1c3pa_ 18 56 1e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice hemizygous or homozygous for the null allele exhibit background sensitive defects in frontal and interparietal bone ossification. On a C57BL/6 background the phenotype is severe leading to death within 4-6 hours of birth from brain hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd1 G A X: 72,774,471 (GRCm39) V489M possibly damaging Het
Anln A T 9: 22,291,594 (GRCm39) V78E probably benign Het
Atp2b4 T C 1: 133,658,216 (GRCm39) K565E probably damaging Het
Cap2 T C 13: 46,768,837 (GRCm39) probably null Het
Cdh22 A G 2: 165,012,576 (GRCm39) Y170H probably damaging Het
Chrna5 A T 9: 54,911,647 (GRCm39) K45I probably damaging Het
Dnaaf4 G T 9: 72,867,939 (GRCm39) G67* probably null Het
Lama1 A G 17: 68,086,037 (GRCm39) probably null Het
Lrba T A 3: 86,205,297 (GRCm39) Y380* probably null Het
Mastl A G 2: 23,041,005 (GRCm39) Y106H probably damaging Het
Obscn T C 11: 58,940,271 (GRCm39) E5210G possibly damaging Het
Or12d2 T A 17: 37,624,975 (GRCm39) H100L probably damaging Het
Or4d5 A G 9: 40,012,726 (GRCm39) V20A probably benign Het
Pcgf2 T C 11: 97,581,830 (GRCm39) Y21C probably damaging Het
Penk T C 4: 4,134,257 (GRCm39) E130G probably benign Het
Rnmt G A 18: 68,440,859 (GRCm39) probably null Het
Stk11ip T A 1: 75,504,091 (GRCm39) L277Q probably damaging Het
Synpo2l A G 14: 20,711,907 (GRCm39) S238P probably damaging Het
Tex264 A C 9: 106,536,431 (GRCm39) L242R possibly damaging Het
Ubald2 T C 11: 116,325,401 (GRCm39) F46S probably damaging Het
Zfp692 T C 11: 58,205,140 (GRCm39) V463A probably benign Het
Predicted Primers PCR Primer
(F):5'- agacacatgcacacTGCCACAC -3'
(R):5'- TTCACGGGAACCAGAAGTTGCGAG -3'

Sequencing Primer
(F):5'- acatacatacatacacacatgcac -3'
(R):5'- ACCAGAAGTTGCGAGTTGTC -3'
Posted On 2013-07-30