Incidental Mutation 'R0715:Gm11639'
ID62831
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission 038898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0715 (G1)
Quality Score82
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104720880 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 516 (L516P)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
Predicted Effect unknown
Transcript: ENSMUST00000148007
AA Change: L443P
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: L443P

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175713
Predicted Effect possibly damaging
Transcript: ENSMUST00000212287
AA Change: L516P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,223,092 C1933S probably benign Het
4930438A08Rik A G 11: 58,288,350 Y170C probably damaging Het
Adcy2 C T 13: 68,888,042 V167I probably benign Het
Agl A G 3: 116,752,176 Y1324H probably damaging Het
Arhgef37 G T 18: 61,508,789 Q170K probably damaging Het
Asah2 A G 19: 32,016,776 S390P probably damaging Het
Atp8a1 A T 5: 67,774,725 H240Q probably benign Het
Btbd16 T A 7: 130,788,827 N151K probably damaging Het
Ccdc73 T A 2: 104,973,154 probably benign Het
Cecr2 G T 6: 120,758,198 M21I probably benign Het
Ckap2l T C 2: 129,285,716 T181A probably benign Het
Col4a3 T C 1: 82,652,158 probably benign Het
Dnah9 A G 11: 66,081,248 probably benign Het
Fat3 T C 9: 16,375,123 T1035A probably benign Het
Fzd8 A G 18: 9,212,947 T10A unknown Het
Gm9631 C A 11: 121,942,502 C636F probably damaging Het
Gp1ba A G 11: 70,640,788 probably benign Het
Gsk3a A G 7: 25,231,709 V277A probably damaging Het
H2-M1 T A 17: 36,670,228 probably benign Het
Hesx1 T A 14: 27,000,852 W45R probably damaging Het
Il23r T A 6: 67,486,333 M59L possibly damaging Het
Insc T A 7: 114,845,077 V433E probably benign Het
Itga8 T C 2: 12,191,242 probably benign Het
Kif13a T A 13: 46,812,823 E436V probably damaging Het
Liph A G 16: 21,995,350 F7S probably benign Het
Lpar2 T C 8: 69,824,173 V204A probably damaging Het
Lrfn4 T A 19: 4,612,640 probably null Het
Man2b2 A T 5: 36,826,058 D182E probably benign Het
Mmp27 T C 9: 7,581,155 probably benign Het
Mrm1 A G 11: 84,814,813 probably benign Het
Mtx3 T C 13: 92,850,361 S271P probably damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Necab2 A G 8: 119,470,931 D332G probably damaging Het
Ngfr A G 11: 95,574,239 I261T possibly damaging Het
Nrap T C 19: 56,357,325 E617G probably damaging Het
Obscn G T 11: 59,050,480 T4505K probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr983 A G 9: 40,092,511 Y148H probably damaging Het
Osbpl11 T A 16: 33,241,730 probably benign Het
Otof A G 5: 30,394,697 V301A probably damaging Het
Phf3 A T 1: 30,811,838 L1145Q probably damaging Het
Phospho2 T A 2: 69,796,196 I232N possibly damaging Het
Pomgnt2 T A 9: 121,982,061 K551N probably damaging Het
Ptchd3 A G 11: 121,831,158 T286A possibly damaging Het
Rnf213 A G 11: 119,441,150 D2396G probably damaging Het
Sh3pxd2b A G 11: 32,423,341 E836G possibly damaging Het
Simc1 G T 13: 54,525,655 M605I possibly damaging Het
Slc12a3 G A 8: 94,329,433 E66K possibly damaging Het
Spg11 T C 2: 122,084,983 N1060S probably benign Het
Supt5 A T 7: 28,329,037 W178R probably damaging Het
Tmem41a G T 16: 21,937,990 F126L probably benign Het
Ube2m T A 7: 13,037,626 Q35L probably benign Het
Usp33 A G 3: 152,380,574 D658G probably damaging Het
Vmn2r12 A T 5: 109,090,507 C456S probably benign Het
Vmn2r81 T A 10: 79,268,600 D352E probably damaging Het
Zfp516 A G 18: 82,987,263 Y764C probably damaging Het
Zswim7 A G 11: 62,276,647 probably benign Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGGATGAGGCTGAACTTAAACTCTCC -3'
(R):5'- CACTTCTATCCAGTGACTTCTTGAGGC -3'

Sequencing Primer
(F):5'- TCTCAAGTGGGATCATCAGC -3'
(R):5'- GCTTGAATCACGTCTATCCGATAAC -3'
Posted On2013-07-30