Incidental Mutation 'R0717:Grid2'
ID62866
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission 038899-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0717 (G1)
Quality Score112
Status Not validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64666275 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1007 (I1007K)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852] [ENSMUST00000210324]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095852
AA Change: I1007K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I1007K

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210324
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
Anxa11 G A 14: 25,874,789 probably null Het
Arhgap33 G T 7: 30,528,349 A475E probably damaging Het
Cacna1s A G 1: 136,098,291 N811S probably damaging Het
Cadm1 T A 9: 47,810,068 M252K probably benign Het
Cars T C 7: 143,584,755 R149G probably damaging Het
Ccdc125 A T 13: 100,690,358 D241V probably damaging Het
Col12a1 G A 9: 79,612,419 P2836S probably damaging Het
Hdhd2 G A 18: 76,951,204 A28T possibly damaging Het
Hivep1 A T 13: 42,154,946 T221S possibly damaging Het
Lztr1 A G 16: 17,516,048 probably null Het
Mbd1 C T 18: 74,273,597 A137V possibly damaging Het
Myh15 T C 16: 49,142,993 V1099A probably benign Het
Nox4 C A 7: 87,304,890 Y134* probably null Het
Olfr177 A G 16: 58,872,770 C127R probably damaging Het
Pde1c T A 6: 56,123,012 N681I probably damaging Het
Pon1 A G 6: 5,193,674 probably null Het
Prokr2 T C 2: 132,381,334 D96G probably damaging Het
Sdk2 C A 11: 113,832,326 V1280F probably damaging Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Tcaf1 A T 6: 42,678,665 M459K probably benign Het
Tmem201 T A 4: 149,718,810 N534Y probably damaging Het
Tspan9 A T 6: 127,966,380 probably null Het
Uba7 A T 9: 107,977,217 T252S probably benign Het
Ube2e2 T C 14: 18,888,435 T3A probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAAAAGCTGCCTCTGGCTTC -3'
(R):5'- AGTGTTCTCAGTGACTCAGTGCCC -3'

Sequencing Primer
(F):5'- GGCTTCGCTTTCGGCAG -3'
(R):5'- gagggtgatagacagagaaagg -3'
Posted On2013-07-30