Incidental Mutation 'R0699:Ntng1'
ID62942
Institutional Source Beutler Lab
Gene Symbol Ntng1
Ensembl Gene ENSMUSG00000059857
Gene Namenetrin G1
SynonymsLmnt1, A930010C08Rik
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0699 (G1)
Quality Score154
Status Validated
Chromosome3
Chromosomal Location109780040-110144011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109872295 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 322 (T322K)
Ref Sequence ENSEMBL: ENSMUSP00000102180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000128219] [ENSMUST00000131027] [ENSMUST00000133268] [ENSMUST00000138344] [ENSMUST00000138953] [ENSMUST00000156177]
Predicted Effect probably damaging
Transcript: ENSMUST00000072596
AA Change: T322K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106570
AA Change: T322K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 1.28e-3 SMART
EGF 388 420 5.12e-3 SMART
low complexity region 444 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106571
AA Change: T322K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 408 440 5.12e-3 SMART
low complexity region 464 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106575
AA Change: T322K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 3.33e-2 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128219
SMART Domains Protein: ENSMUSP00000116579
Gene: ENSMUSG00000059857

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LamNT 59 295 1.5e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131027
AA Change: T322K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF 421 453 5.12e-3 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133268
AA Change: T322K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 365 397 5.12e-3 SMART
low complexity region 421 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138344
AA Change: T322K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 406 5.74e-6 SMART
EGF 410 442 5.12e-3 SMART
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138953
AA Change: T322K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 407 439 5.12e-3 SMART
low complexity region 463 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156177
AA Change: T322K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: T322K

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 387 419 5.12e-3 SMART
low complexity region 443 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189335
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Ntng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Ntng1 APN 3 109934995 nonsense probably null
IGL02367:Ntng1 APN 3 110135513 unclassified probably null
IGL02448:Ntng1 APN 3 109934559 splice site probably benign
IGL02487:Ntng1 APN 3 109935047 missense probably damaging 0.98
IGL02500:Ntng1 APN 3 110135330 missense probably damaging 1.00
IGL02578:Ntng1 APN 3 110135394 missense probably benign 0.01
IGL03009:Ntng1 APN 3 109934702 missense possibly damaging 0.89
IGL03096:Ntng1 APN 3 110135349 missense probably benign 0.19
R0108:Ntng1 UTSW 3 109851755 splice site probably benign
R0326:Ntng1 UTSW 3 110135503 nonsense probably null
R0403:Ntng1 UTSW 3 109934611 missense probably damaging 0.97
R0702:Ntng1 UTSW 3 109872254 missense probably damaging 1.00
R1981:Ntng1 UTSW 3 109935010 missense possibly damaging 0.61
R2096:Ntng1 UTSW 3 109832555 missense probably damaging 0.99
R3739:Ntng1 UTSW 3 109934691 missense probably damaging 1.00
R3963:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4484:Ntng1 UTSW 3 110143808 unclassified probably benign
R4516:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4518:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4520:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4523:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4524:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4776:Ntng1 UTSW 3 109934713 missense probably damaging 1.00
R4817:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4827:Ntng1 UTSW 3 110135411 missense probably damaging 1.00
R4990:Ntng1 UTSW 3 110135261 critical splice donor site probably null
R5067:Ntng1 UTSW 3 110135345 missense possibly damaging 0.95
R5087:Ntng1 UTSW 3 110135329 nonsense probably null
R5196:Ntng1 UTSW 3 109934983 missense probably damaging 1.00
R5263:Ntng1 UTSW 3 109934872 missense probably damaging 0.99
R5743:Ntng1 UTSW 3 110135420 missense probably damaging 1.00
R6268:Ntng1 UTSW 3 109935035 missense probably damaging 1.00
R6292:Ntng1 UTSW 3 110143886 unclassified probably benign
R6419:Ntng1 UTSW 3 109782853 missense possibly damaging 0.95
R6898:Ntng1 UTSW 3 109872218 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCGATTAGAGTGCTAACACATGC -3'
(R):5'- TCAATGGTCCCTTCTCCCAAAGGC -3'

Sequencing Primer
(F):5'- GTGCTAACACATGCTTACAAATGG -3'
(R):5'- CACAAAAATGCTGTGTGGTTTGAG -3'
Posted On2013-07-30