Incidental Mutation 'R0699:Dysf'
ID62955
Institutional Source Beutler Lab
Gene Symbol Dysf
Ensembl Gene ENSMUSG00000033788
Gene Namedysferlin
Synonyms2310004N10Rik
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0699 (G1)
Quality Score94
Status Validated
Chromosome6
Chromosomal Location84008590-84211060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84190846 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1757 (R1757W)
Ref Sequence ENSEMBL: ENSMUSP00000144970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000153860] [ENSMUST00000168387] [ENSMUST00000203695] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000204591] [ENSMUST00000204987]
Predicted Effect probably benign
Transcript: ENSMUST00000081904
AA Change: R1737W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788
AA Change: R1737W

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 4.84e-14 SMART
FerI 337 408 5.3e-39 SMART
C2 414 528 2.96e-9 SMART
FerA 714 779 6.3e-23 SMART
FerB 806 880 2.49e-44 SMART
DysFN 894 953 1.42e-22 SMART
DysFN 966 1022 2.65e-22 SMART
DysFC 1031 1069 1.33e-13 SMART
DysFC 1088 1121 1.1e-10 SMART
C2 1173 1281 2.63e-15 SMART
C2 1350 1457 7.13e0 SMART
C2 1599 1698 2.52e-12 SMART
C2 1832 1961 1.55e-3 SMART
Pfam:Ferlin_C 1991 2095 6.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089595
AA Change: R1720W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788
AA Change: R1720W

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 1.12e-9 SMART
FerA 697 762 6.3e-23 SMART
FerB 789 863 2.49e-44 SMART
DysFN 877 936 1.42e-22 SMART
DysFN 949 1005 2.65e-22 SMART
DysFC 1014 1052 1.33e-13 SMART
DysFC 1071 1104 1.1e-10 SMART
C2 1156 1264 2.63e-15 SMART
C2 1333 1440 7.13e0 SMART
C2 1582 1681 2.52e-12 SMART
C2 1815 1944 1.55e-3 SMART
Pfam:Ferlin_C 1974 2078 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113818
AA Change: R1706W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788
AA Change: R1706W

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 2.96e-9 SMART
FerA 683 748 6.3e-23 SMART
FerB 775 849 2.49e-44 SMART
DysFN 863 922 1.42e-22 SMART
DysFN 935 991 2.65e-22 SMART
DysFC 1000 1038 1.33e-13 SMART
DysFC 1057 1090 1.1e-10 SMART
C2 1142 1250 2.63e-15 SMART
C2 1319 1426 7.13e0 SMART
C2 1568 1667 2.52e-12 SMART
C2 1801 1930 1.55e-3 SMART
transmembrane domain 2034 2056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113821
AA Change: R1719W

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788
AA Change: R1719W

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 696 761 6.3e-23 SMART
FerB 788 862 2.49e-44 SMART
DysFN 876 935 1.42e-22 SMART
DysFN 948 1004 2.65e-22 SMART
DysFC 1013 1051 1.33e-13 SMART
DysFC 1070 1103 1.1e-10 SMART
C2 1155 1263 2.63e-15 SMART
C2 1332 1439 7.13e0 SMART
C2 1581 1680 2.52e-12 SMART
C2 1814 1943 1.55e-3 SMART
transmembrane domain 2047 2069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113823
AA Change: R1736W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788
AA Change: R1736W

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 4.84e-14 SMART
FerI 336 407 5.3e-39 SMART
C2 413 527 2.96e-9 SMART
FerA 713 778 6.3e-23 SMART
FerB 805 879 2.49e-44 SMART
DysFN 893 952 1.42e-22 SMART
DysFN 965 1021 2.65e-22 SMART
DysFC 1030 1068 1.33e-13 SMART
DysFC 1087 1120 1.1e-10 SMART
C2 1172 1280 2.63e-15 SMART
C2 1349 1456 7.13e0 SMART
C2 1598 1697 2.52e-12 SMART
C2 1831 1960 1.55e-3 SMART
transmembrane domain 2064 2086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153860
AA Change: R1740W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788
AA Change: R1740W

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 3.2e-16 SMART
FerI 305 376 2.6e-43 SMART
C2 382 496 7.4e-12 SMART
FerA 696 761 3.1e-27 SMART
FerB 788 862 1.2e-48 SMART
DysFN 876 935 5.3e-25 SMART
DysFN 948 1004 9.6e-25 SMART
DysFC 1013 1051 4.7e-16 SMART
DysFC 1070 1103 4.1e-13 SMART
C2 1155 1263 1.7e-17 SMART
C2 1332 1439 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168387
AA Change: R1727W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788
AA Change: R1727W

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 704 769 6.3e-23 SMART
FerB 796 870 2.49e-44 SMART
DysFN 884 943 1.42e-22 SMART
DysFN 956 1012 2.65e-22 SMART
DysFC 1021 1059 1.33e-13 SMART
DysFC 1078 1111 1.1e-10 SMART
C2 1163 1271 2.63e-15 SMART
C2 1340 1447 7.13e0 SMART
C2 1589 1688 2.52e-12 SMART
C2 1822 1951 1.55e-3 SMART
transmembrane domain 2055 2077 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203695
AA Change: R1751W

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788
AA Change: R1751W

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 3.2e-16 SMART
FerI 337 408 2.6e-43 SMART
C2 414 528 7.4e-12 SMART
FerA 728 793 3.1e-27 SMART
FerB 820 894 1.2e-48 SMART
DysFN 908 967 5.3e-25 SMART
DysFN 980 1036 9.6e-25 SMART
DysFC 1045 1083 4.7e-16 SMART
DysFC 1102 1135 4.1e-13 SMART
C2 1187 1295 1.7e-17 SMART
C2 1364 1471 4.7e-2 SMART
C2 1613 1712 1.7e-14 SMART
C2 1846 1975 1.1e-5 SMART
Pfam:Ferlin_C 2005 2109 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203803
AA Change: R1740W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788
AA Change: R1740W

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 7.4e-12 SMART
FerA 727 792 3.1e-27 SMART
FerB 819 893 1.2e-48 SMART
DysFN 907 966 5.3e-25 SMART
DysFN 979 1035 9.6e-25 SMART
DysFC 1044 1082 4.7e-16 SMART
DysFC 1101 1134 4.1e-13 SMART
C2 1186 1294 1.7e-17 SMART
C2 1353 1460 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204354
AA Change: R1727W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788
AA Change: R1727W

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 2e-11 SMART
FerA 683 748 3.1e-27 SMART
FerB 775 849 1.2e-48 SMART
DysFN 863 922 5.3e-25 SMART
DysFN 935 991 9.6e-25 SMART
DysFC 1000 1038 4.7e-16 SMART
DysFC 1057 1090 4.1e-13 SMART
C2 1142 1250 1.7e-17 SMART
C2 1319 1426 4.7e-2 SMART
C2 1589 1688 1.7e-14 SMART
C2 1822 1951 1.1e-5 SMART
Pfam:Ferlin_C 1981 2085 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204591
AA Change: R1757W

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788
AA Change: R1757W

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 2e-11 SMART
FerA 713 778 3.1e-27 SMART
FerB 805 879 1.2e-48 SMART
DysFN 893 952 5.3e-25 SMART
DysFN 965 1021 9.6e-25 SMART
DysFC 1030 1068 4.7e-16 SMART
DysFC 1087 1120 4.1e-13 SMART
C2 1172 1280 1.7e-17 SMART
C2 1349 1456 4.7e-2 SMART
C2 1619 1718 1.7e-14 SMART
C2 1852 1981 1.1e-5 SMART
Pfam:Ferlin_C 2011 2115 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204987
AA Change: R1741W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788
AA Change: R1741W

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 7.4e-12 SMART
FerA 697 762 3.1e-27 SMART
FerB 789 863 1.2e-48 SMART
DysFN 877 936 5.3e-25 SMART
DysFN 949 1005 9.6e-25 SMART
DysFC 1014 1052 4.7e-16 SMART
DysFC 1071 1104 4.1e-13 SMART
C2 1156 1264 1.7e-17 SMART
C2 1333 1440 4.7e-2 SMART
C2 1603 1702 1.7e-14 SMART
C2 1836 1965 1.1e-5 SMART
Pfam:Ferlin_C 1995 2099 4.4e-22 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Dysf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Dysf APN 6 84108099 missense probably damaging 1.00
IGL00340:Dysf APN 6 84141951 missense probably benign 0.02
IGL00429:Dysf APN 6 84189844 missense probably damaging 1.00
IGL00465:Dysf APN 6 84199848 critical splice donor site probably null
IGL00800:Dysf APN 6 84149998 missense probably damaging 1.00
IGL01069:Dysf APN 6 84199785 missense possibly damaging 0.94
IGL01094:Dysf APN 6 84194386 missense probably damaging 1.00
IGL01420:Dysf APN 6 84149759 nonsense probably null
IGL01649:Dysf APN 6 84199839 missense probably damaging 1.00
IGL01923:Dysf APN 6 84210829 makesense probably null
IGL01991:Dysf APN 6 84113618 missense probably damaging 1.00
IGL01999:Dysf APN 6 84113618 missense probably damaging 1.00
IGL02002:Dysf APN 6 84210787 splice site probably benign
IGL02136:Dysf APN 6 84108167 missense probably benign 0.43
IGL02318:Dysf APN 6 84186464 missense possibly damaging 0.50
IGL02378:Dysf APN 6 84111905 missense probably damaging 1.00
IGL02404:Dysf APN 6 84116061 missense probably damaging 1.00
IGL02416:Dysf APN 6 84192914 missense possibly damaging 0.92
IGL02535:Dysf APN 6 84149697 missense possibly damaging 0.45
IGL02553:Dysf APN 6 84130127 missense possibly damaging 0.95
IGL02559:Dysf APN 6 84067446 splice site probably benign
IGL02563:Dysf APN 6 84186516 splice site probably benign
IGL02647:Dysf APN 6 84137373 missense probably damaging 1.00
IGL02820:Dysf APN 6 84100205 missense probably damaging 0.99
IGL02858:Dysf APN 6 84099489 missense probably benign 0.01
IGL02860:Dysf APN 6 84190898 critical splice donor site probably null
IGL02861:Dysf APN 6 84039537 missense probably damaging 0.99
IGL03008:Dysf APN 6 84073894 missense probably benign 0.01
IGL03023:Dysf APN 6 84193007 missense probably damaging 1.00
IGL03074:Dysf APN 6 84188226 missense probably benign 0.25
IGL03342:Dysf APN 6 84190872 missense probably benign
R0067:Dysf UTSW 6 84063331 missense possibly damaging 0.58
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0124:Dysf UTSW 6 84065102 splice site probably benign
R0219:Dysf UTSW 6 84129461 splice site probably benign
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0426:Dysf UTSW 6 84149757 missense probably damaging 1.00
R0455:Dysf UTSW 6 84140667 missense probably benign 0.29
R0482:Dysf UTSW 6 84152405 missense probably benign 0.03
R0545:Dysf UTSW 6 84099461 missense probably damaging 0.99
R0625:Dysf UTSW 6 84111987 splice site probably null
R0676:Dysf UTSW 6 84113336 missense probably benign 0.07
R1165:Dysf UTSW 6 84067069 missense probably damaging 0.98
R1455:Dysf UTSW 6 84113386 missense probably benign 0.01
R1582:Dysf UTSW 6 84097767 missense probably damaging 1.00
R1584:Dysf UTSW 6 84067047 missense probably benign 0.04
R1605:Dysf UTSW 6 84106941 missense probably damaging 0.96
R1674:Dysf UTSW 6 84179715 missense probably benign 0.01
R1739:Dysf UTSW 6 84112235 critical splice donor site probably null
R1765:Dysf UTSW 6 84190902 splice site probably null
R1813:Dysf UTSW 6 84151924 missense possibly damaging 0.83
R1900:Dysf UTSW 6 84039567 missense probably damaging 0.97
R1960:Dysf UTSW 6 84073903 missense probably benign 0.12
R2216:Dysf UTSW 6 84207245 splice site probably null
R2242:Dysf UTSW 6 84186509 critical splice donor site probably null
R2243:Dysf UTSW 6 84186509 critical splice donor site probably null
R2245:Dysf UTSW 6 84186509 critical splice donor site probably null
R2246:Dysf UTSW 6 84186509 critical splice donor site probably null
R2280:Dysf UTSW 6 84064494 missense probably damaging 0.99
R2374:Dysf UTSW 6 84097729 missense probably damaging 1.00
R2403:Dysf UTSW 6 84039567 missense possibly damaging 0.84
R2763:Dysf UTSW 6 84106932 missense probably benign 0.00
R2895:Dysf UTSW 6 84186509 critical splice donor site probably null
R2916:Dysf UTSW 6 84186509 critical splice donor site probably null
R2918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3402:Dysf UTSW 6 84186509 critical splice donor site probably null
R3403:Dysf UTSW 6 84186509 critical splice donor site probably null
R3434:Dysf UTSW 6 84070888 missense probably benign 0.00
R3772:Dysf UTSW 6 84152351 missense possibly damaging 0.63
R3781:Dysf UTSW 6 84186509 critical splice donor site probably null
R3789:Dysf UTSW 6 84186509 critical splice donor site probably null
R3822:Dysf UTSW 6 84207088 splice site probably benign
R3918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3919:Dysf UTSW 6 84186509 critical splice donor site probably null
R3939:Dysf UTSW 6 84186509 critical splice donor site probably null
R3942:Dysf UTSW 6 84186509 critical splice donor site probably null
R4177:Dysf UTSW 6 84067031 nonsense probably null
R4179:Dysf UTSW 6 84186509 critical splice donor site probably null
R4180:Dysf UTSW 6 84186509 critical splice donor site probably null
R4299:Dysf UTSW 6 84068077 missense possibly damaging 0.78
R4419:Dysf UTSW 6 84207242 critical splice donor site probably null
R4446:Dysf UTSW 6 84205872 missense probably damaging 1.00
R4577:Dysf UTSW 6 84137326 missense probably damaging 1.00
R4680:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4708:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4709:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4710:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4725:Dysf UTSW 6 84097756 missense probably damaging 1.00
R4742:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4743:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4749:Dysf UTSW 6 84067008 missense probably damaging 1.00
R4787:Dysf UTSW 6 84203328 nonsense probably null
R4850:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4868:Dysf UTSW 6 84179693 missense probably damaging 1.00
R4871:Dysf UTSW 6 84067023 missense possibly damaging 0.93
R4951:Dysf UTSW 6 84114120 critical splice donor site probably null
R4952:Dysf UTSW 6 84149986 missense possibly damaging 0.79
R5009:Dysf UTSW 6 84151986 missense probably damaging 1.00
R5072:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5073:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5074:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5252:Dysf UTSW 6 84186468 missense probably damaging 0.98
R5260:Dysf UTSW 6 84150034 missense probably damaging 1.00
R5447:Dysf UTSW 6 84195263 missense probably damaging 0.98
R5501:Dysf UTSW 6 84087818 missense probably damaging 0.99
R5533:Dysf UTSW 6 84186471 missense probably damaging 0.99
R5611:Dysf UTSW 6 84064878 missense probably damaging 0.98
R5618:Dysf UTSW 6 84106824 missense probably benign 0.03
R5884:Dysf UTSW 6 84186081 missense probably damaging 1.00
R5927:Dysf UTSW 6 84207212 missense probably damaging 1.00
R6045:Dysf UTSW 6 84114072 missense probably damaging 0.99
R6056:Dysf UTSW 6 84106862 missense probably benign
R6084:Dysf UTSW 6 84019604 missense probably damaging 0.98
R6084:Dysf UTSW 6 84112119 missense probably damaging 1.00
R6146:Dysf UTSW 6 84203199 missense probably damaging 0.96
R6220:Dysf UTSW 6 84149745 missense probably damaging 0.97
R6232:Dysf UTSW 6 84098253 missense probably benign 0.26
R6247:Dysf UTSW 6 84066999 missense probably damaging 1.00
R6298:Dysf UTSW 6 84107136 intron probably null
R6306:Dysf UTSW 6 84137266 missense possibly damaging 0.91
R6377:Dysf UTSW 6 84008963 missense probably benign
R6415:Dysf UTSW 6 84140042 missense probably damaging 1.00
R6444:Dysf UTSW 6 84190840 missense probably benign 0.36
R6470:Dysf UTSW 6 84066944 missense possibly damaging 0.93
R6504:Dysf UTSW 6 84008925 missense probably benign 0.03
R6557:Dysf UTSW 6 84186384 missense probably damaging 0.99
R6665:Dysf UTSW 6 84130116 missense probably benign
R6701:Dysf UTSW 6 84112190 missense probably damaging 1.00
R6776:Dysf UTSW 6 84064894 missense possibly damaging 0.88
R6909:Dysf UTSW 6 84192938 missense probably damaging 1.00
X0063:Dysf UTSW 6 84063354 missense probably damaging 0.97
X0066:Dysf UTSW 6 84114102 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCATGGGCAATGCTGTGTGAG -3'
(R):5'- ACTGCCTGAAATCGTGCCTTCTAC -3'

Sequencing Primer
(F):5'- GTGTGGGGTGCAAAGGC -3'
(R):5'- gaggagcagtcagcacag -3'
Posted On2013-07-30