Incidental Mutation 'R0699:Kif13a'
ID62970
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R0699 (G1)
Quality Score93
Status Validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46799213 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 699 (W699R)
Ref Sequence ENSEMBL: ENSMUSP00000153614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056978
AA Change: W762R

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: W762R

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225591
AA Change: W699R

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATTCCGTGTCCACCGGACTGAATC -3'
(R):5'- GTGTGCTAAGTAAGTCACCTGAGCC -3'

Sequencing Primer
(F):5'- GTCTTCATTCGGCCAAGTCT -3'
(R):5'- CTCACGGTTGAATCTGTGTAAC -3'
Posted On2013-07-30