Incidental Mutation 'R0699:Cntnap5c'
ID62982
Institutional Source Beutler Lab
Gene Symbol Cntnap5c
Ensembl Gene ENSMUSG00000038048
Gene Namecontactin associated protein-like 5C
Synonyms
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0699 (G1)
Quality Score166
Status Validated
Chromosome17
Chromosomal Location57769570-58410355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 58042498 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 269 (W269G)
Ref Sequence ENSEMBL: ENSMUSP00000075416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076038]
Predicted Effect probably damaging
Transcript: ENSMUST00000076038
AA Change: W269G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: W269G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 29 174 1.26e-10 SMART
LamG 201 338 1.57e-29 SMART
LamG 387 521 3e-26 SMART
EGF 549 583 1.88e-1 SMART
Blast:FBG 586 769 8e-83 BLAST
LamG 811 938 4.37e-28 SMART
EGF 959 995 6.55e-1 SMART
LamG 1036 1172 2.08e-11 SMART
transmembrane domain 1240 1262 N/A INTRINSIC
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Cntnap5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Cntnap5c APN 17 58162277 missense probably benign 0.00
IGL00543:Cntnap5c APN 17 58294350 missense probably benign
IGL00679:Cntnap5c APN 17 58055678 missense probably damaging 0.98
IGL00942:Cntnap5c APN 17 57769598 missense probably benign 0.03
IGL01352:Cntnap5c APN 17 58293901 missense probably benign 0.00
IGL01822:Cntnap5c APN 17 58055705 missense probably damaging 0.99
IGL01864:Cntnap5c APN 17 58410242 missense probably benign
IGL01922:Cntnap5c APN 17 58330119 missense possibly damaging 0.95
IGL02111:Cntnap5c APN 17 58102108 missense probably damaging 1.00
IGL02112:Cntnap5c APN 17 58313858 missense probably benign 0.00
IGL02259:Cntnap5c APN 17 58034862 missense probably damaging 0.98
IGL02270:Cntnap5c APN 17 58034853 missense probably benign 0.08
IGL02312:Cntnap5c APN 17 58138699 missense probably benign 0.09
IGL02456:Cntnap5c APN 17 58407744 splice site probably benign
IGL02755:Cntnap5c APN 17 58364194 missense probably benign 0.02
IGL02955:Cntnap5c APN 17 57892102 splice site probably benign
IGL03001:Cntnap5c APN 17 58055639 missense probably damaging 1.00
IGL03012:Cntnap5c APN 17 58359234 missense probably benign 0.01
IGL03243:Cntnap5c APN 17 58102176 missense probably benign 0.01
IGL03375:Cntnap5c APN 17 58162205 missense possibly damaging 0.94
IGL02802:Cntnap5c UTSW 17 58305684 missense probably benign 0.04
LCD18:Cntnap5c UTSW 17 58162160 intron probably benign
R0003:Cntnap5c UTSW 17 58199017 missense probably benign
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0179:Cntnap5c UTSW 17 57769625 missense probably benign 0.19
R0244:Cntnap5c UTSW 17 58102168 missense probably damaging 1.00
R0445:Cntnap5c UTSW 17 58104743 missense probably benign 0.01
R0626:Cntnap5c UTSW 17 58042427 missense probably benign 0.29
R0675:Cntnap5c UTSW 17 58034995 missense probably damaging 1.00
R0681:Cntnap5c UTSW 17 58305555 missense possibly damaging 0.91
R0927:Cntnap5c UTSW 17 58042558 missense possibly damaging 0.78
R1081:Cntnap5c UTSW 17 58305525 missense possibly damaging 0.90
R1132:Cntnap5c UTSW 17 58294356 missense probably damaging 1.00
R1175:Cntnap5c UTSW 17 58364246 missense possibly damaging 0.51
R1640:Cntnap5c UTSW 17 58395294 missense probably benign 0.01
R1664:Cntnap5c UTSW 17 58293990 missense probably benign 0.00
R1758:Cntnap5c UTSW 17 58042550 missense probably damaging 1.00
R1785:Cntnap5c UTSW 17 58162291 missense probably benign 0.00
R1789:Cntnap5c UTSW 17 58013921 missense probably damaging 1.00
R1968:Cntnap5c UTSW 17 58359296 missense probably damaging 1.00
R2041:Cntnap5c UTSW 17 58104770 critical splice donor site probably null
R2041:Cntnap5c UTSW 17 58198989 missense probably benign 0.02
R2073:Cntnap5c UTSW 17 58305552 missense possibly damaging 0.58
R2093:Cntnap5c UTSW 17 58199000 missense probably benign 0.00
R2134:Cntnap5c UTSW 17 58407722 missense probably damaging 1.00
R2153:Cntnap5c UTSW 17 58055671 missense possibly damaging 0.90
R2176:Cntnap5c UTSW 17 58013946 missense probably benign 0.04
R2256:Cntnap5c UTSW 17 58330315 missense probably benign 0.00
R2847:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2848:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2850:Cntnap5c UTSW 17 58410348 utr 3 prime probably benign
R3008:Cntnap5c UTSW 17 58359209 missense probably damaging 1.00
R3714:Cntnap5c UTSW 17 57892067 nonsense probably null
R3720:Cntnap5c UTSW 17 58330202 missense probably benign
R3755:Cntnap5c UTSW 17 58104599 missense possibly damaging 0.82
R4001:Cntnap5c UTSW 17 58407740 critical splice donor site probably null
R4619:Cntnap5c UTSW 17 58410268 missense probably benign
R5146:Cntnap5c UTSW 17 58013847 missense probably damaging 0.96
R5309:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5312:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5722:Cntnap5c UTSW 17 58313857 missense probably benign 0.01
R5974:Cntnap5c UTSW 17 57876485 missense probably benign 0.00
R6017:Cntnap5c UTSW 17 58104698 missense probably benign 0.41
R6059:Cntnap5c UTSW 17 58313712 missense probably damaging 0.99
R6152:Cntnap5c UTSW 17 58286886 missense possibly damaging 0.65
R6182:Cntnap5c UTSW 17 57876395 missense probably benign 0.00
R6298:Cntnap5c UTSW 17 58104752 missense probably damaging 1.00
R6301:Cntnap5c UTSW 17 57892037 missense probably benign 0.01
R6514:Cntnap5c UTSW 17 58330170 missense probably damaging 0.96
R6583:Cntnap5c UTSW 17 58330277 missense probably damaging 1.00
R6688:Cntnap5c UTSW 17 58293904 missense possibly damaging 0.71
R6781:Cntnap5c UTSW 17 58138653 nonsense probably null
R6866:Cntnap5c UTSW 17 58092294 missense probably benign
R6906:Cntnap5c UTSW 17 58395307 missense probably benign 0.18
R6911:Cntnap5c UTSW 17 57892014 missense probably damaging 1.00
R6919:Cntnap5c UTSW 17 58293953 missense probably benign 0.02
R6923:Cntnap5c UTSW 17 58092350 missense possibly damaging 0.96
R6925:Cntnap5c UTSW 17 58395266 missense probably benign 0.39
R6982:Cntnap5c UTSW 17 58092252 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTGCATGACTCCTTCTGTATGCCTG -3'
(R):5'- TCTTGGAGAGTCCTCCCTTGTAGC -3'

Sequencing Primer
(F):5'- CAATGTGGAGGGACAGCTTTG -3'
(R):5'- CTTGTAGCCTAGCCCAGATG -3'
Posted On2013-07-30