Incidental Mutation 'R0699:Tigd3'
ID62985
Institutional Source Beutler Lab
Gene Symbol Tigd3
Ensembl Gene ENSMUSG00000044390
Gene Nametigger transposable element derived 3
Synonyms
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.736) question?
Stock #R0699 (G1)
Quality Score162
Status Validated
Chromosome19
Chromosomal Location5891139-5894107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5891946 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 385 (S385R)
Ref Sequence ENSEMBL: ENSMUSP00000059302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055911] [ENSMUST00000136983]
Predicted Effect probably benign
Transcript: ENSMUST00000055911
AA Change: S385R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059302
Gene: ENSMUSG00000044390
AA Change: S385R

DomainStartEndE-ValueType
Pfam:CENP-B_N 6 59 2.5e-15 PFAM
CENPB 73 137 2.96e-7 SMART
Pfam:DDE_1 192 360 7.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136983
SMART Domains Protein: ENSMUSP00000120125
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 6.2e-41 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 178 196 N/A INTRINSIC
ZnF_C2H2 209 232 4.47e-3 SMART
PHD 272 328 8.64e-9 SMART
RING 273 327 3.83e0 SMART
PHD 329 375 8.9e-11 SMART
RING 330 374 9.75e-1 SMART
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Tigd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0456:Tigd3 UTSW 19 5892793 missense probably damaging 1.00
R1416:Tigd3 UTSW 19 5891725 missense probably benign
R3945:Tigd3 UTSW 19 5892433 missense probably damaging 0.98
R5945:Tigd3 UTSW 19 5891866 missense probably benign
R6253:Tigd3 UTSW 19 5892842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGTTGCATTCAAGCCACC -3'
(R):5'- CGTCACCGTCTACTGAGCAAACTG -3'

Sequencing Primer
(F):5'- TTCAAGCCACCTCCTCAGG -3'
(R):5'- TCTACTGAGCAAACTGGCTGC -3'
Posted On2013-07-30