Incidental Mutation 'R0699:F8'
ID62986
Institutional Source Beutler Lab
Gene Symbol F8
Ensembl Gene ENSMUSG00000031196
Gene Namecoagulation factor VIII
SynonymsFVIII, Cf8, Factor VIII, Cf-8
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0699 (G1)
Quality Score118
Status Validated
ChromosomeX
Chromosomal Location75172715-75382615 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 75379624 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033539] [ENSMUST00000033541] [ENSMUST00000114085] [ENSMUST00000147349] [ENSMUST00000151772]
Predicted Effect unknown
Transcript: ENSMUST00000033539
AA Change: I3M
SMART Domains Protein: ENSMUSP00000033539
Gene: ENSMUSG00000031196
AA Change: I3M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.6e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 444 577 8.8e-7 PFAM
low complexity region 1210 1231 N/A INTRINSIC
low complexity region 1268 1278 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
internal_repeat_1 1683 2005 3.96e-46 PROSPERO
FA58C 2007 2156 7.3e-48 SMART
FA58C 2160 2313 2.36e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033541
SMART Domains Protein: ENSMUSP00000033541
Gene: ENSMUSG00000031198

DomainStartEndE-ValueType
Pfam:FUN14 49 149 2.4e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000114085
AA Change: I3M
SMART Domains Protein: ENSMUSP00000109719
Gene: ENSMUSG00000031196
AA Change: I3M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.1e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 446 577 7.4e-7 PFAM
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1198 1208 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
internal_repeat_2 1613 1838 3.99e-33 PROSPERO
internal_repeat_1 1615 1935 1.02e-41 PROSPERO
FA58C 1937 2086 7.3e-48 SMART
FA58C 2090 2243 2.36e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147349
SMART Domains Protein: ENSMUSP00000114207
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 82 196 5.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147998
Predicted Effect probably benign
Transcript: ENSMUST00000151772
SMART Domains Protein: ENSMUSP00000117919
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 36 114 5.4e-8 PFAM
Meta Mutation Damage Score 0.1864 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male hemizygotes and female homozygotes for targeted null mutations produce no factor VIII, but are apparently healthy and fertile. However, affected mice show prolonged, exsanguinating bleeding following tail-clipping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in F8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:F8 APN X 75334180 unclassified probably benign
IGL01079:F8 APN X 75286618 missense probably damaging 0.98
IGL01101:F8 APN X 75287387 missense possibly damaging 0.62
IGL01160:F8 APN X 75288061 missense probably damaging 0.99
IGL01397:F8 APN X 75379539 missense probably benign
IGL02043:F8 APN X 75332641 missense probably benign 0.00
IGL02479:F8 APN X 75288240 missense probably damaging 0.98
IGL02505:F8 APN X 75379598 intron probably benign
IGL02869:F8 APN X 75287381 missense probably benign 0.00
IGL03004:F8 APN X 75212052 missense probably damaging 1.00
R0657:F8 UTSW X 75211416 missense possibly damaging 0.86
R2035:F8 UTSW X 75322998 frame shift probably null
R2037:F8 UTSW X 75322998 frame shift probably null
R3436:F8 UTSW X 75267424 splice site probably benign
R3735:F8 UTSW X 75211375 missense probably damaging 1.00
R3736:F8 UTSW X 75211375 missense probably damaging 1.00
R3792:F8 UTSW X 75285365 critical splice donor site probably null
X0009:F8 UTSW X 75287783 missense probably benign 0.36
Z1088:F8 UTSW X 75323149 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATTACTGACTGGACCCCTTAGTCTACG -3'
(R):5'- GTGCCTGCTTCCTACTACCCAAAAG -3'

Sequencing Primer
(F):5'- cacacacatacacacaaacaaac -3'
(R):5'- GTGCTAATGCTACTTTCACTCACAG -3'
Posted On2013-07-30