Incidental Mutation 'R0701:Zap70'
ID62988
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
MMRRC Submission 038884-MU
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R0701 (G1)
Quality Score141
Status Not validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36781177 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 513 (R513Q)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
Predicted Effect probably damaging
Transcript: ENSMUST00000027291
AA Change: R513Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: R513Q

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190128
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense probably damaging 1.00
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
want_to UTSW 1 36782517 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36778751 missense probably benign
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Predicted Primers PCR Primer
(F):5'- ATGCCAGCCACATCACTGATGC -3'
(R):5'- TCATTTTCTGCTCAGGCCAGGGAC -3'

Sequencing Primer
(F):5'- ACTGGTCAATCGGCACTATG -3'
(R):5'- CCAGGGACAAAGGCATTCG -3'
Posted On2013-07-30