Incidental Mutation 'R0701:Ada'
ID63000
Institutional Source Beutler Lab
Gene Symbol Ada
Ensembl Gene ENSMUSG00000017697
Gene Nameadenosine deaminase
Synonyms
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0701 (G1)
Quality Score173
Status Not validated
Chromosome2
Chromosomal Location163726584-163750239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163730075 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 261 (V261A)
Ref Sequence ENSEMBL: ENSMUSP00000017841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017841] [ENSMUST00000064703] [ENSMUST00000099105] [ENSMUST00000109400] [ENSMUST00000126182] [ENSMUST00000131228] [ENSMUST00000135537] [ENSMUST00000164399]
PDB Structure
ADA STRUCTURE COMPLEXED WITH DEOXYCOFORMYCIN AT PH 7.0 [X-RAY DIFFRACTION]
ADA STRUCTURE COMPLEXED WITH PURINE RIBOSIDE AT PH 7.0 [X-RAY DIFFRACTION]
A PRE-TRANSITION STATE MIMIC OF AN ENZYME: X-RAY STRUCTURE OF ADENOSINE DEAMINASE WITH BOUND 1-DEAZA-ADENOSINE AND ZINC-ACTIVATED WATER [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D295E) [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D296A) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 ALA MUTANT) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 GLU MUTANT) [X-RAY DIFFRACTION]
ATOMIC STRUCTURE OF ADENOSINE DEAMINASE COMPLEXED WITH A TRANSITION-STATE ANALOG: UNDERSTANDING CATALYSIS AND IMMUNODEFICIENCY MUTATIONS [X-RAY DIFFRACTION]
Crystal structuore of adenosine deaminase from mus musculus complexed with 9-deazainosine [X-RAY DIFFRACTION]
Crystal structure of holo mADA at 1.6 A resolution [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000017841
AA Change: V261A

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017841
Gene: ENSMUSG00000017697
AA Change: V261A

DomainStartEndE-ValueType
Pfam:A_deaminase 8 346 1.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064703
SMART Domains Protein: ENSMUSP00000068344
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 70 5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099105
SMART Domains Protein: ENSMUSP00000096704
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109400
SMART Domains Protein: ENSMUSP00000105027
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126182
SMART Domains Protein: ENSMUSP00000120145
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131228
SMART Domains Protein: ENSMUSP00000120355
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 70 4.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135537
SMART Domains Protein: ENSMUSP00000114291
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 56 7.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156939
Predicted Effect probably benign
Transcript: ENSMUST00000164399
SMART Domains Protein: ENSMUSP00000126223
Gene: ENSMUSG00000035268

DomainStartEndE-ValueType
Pfam:PKI 2 75 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die perinatally with defective purine metabolism and severe liver cell degeneration, but lack thymic abnormalities. Replacement of placental ADA can rescue ADA-deficient fetuses, resulting in mice that are T and B-cell deficient, have elevated dATP levels, and immune deficiencies resembling human ADA deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Ada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Ada APN 2 163730316 missense probably benign 0.02
IGL02414:Ada APN 2 163730040 missense probably benign
IGL02973:Ada APN 2 163731133 missense probably benign 0.01
R0053:Ada UTSW 2 163732292 missense probably damaging 0.99
R0076:Ada UTSW 2 163727603 unclassified probably benign
R0305:Ada UTSW 2 163728157 missense probably benign 0.00
R0463:Ada UTSW 2 163730351 missense probably benign 0.00
R0464:Ada UTSW 2 163732964 nonsense probably null
R1474:Ada UTSW 2 163732894 missense possibly damaging 0.94
R4044:Ada UTSW 2 163735460 missense probably damaging 0.96
R4589:Ada UTSW 2 163732948 missense possibly damaging 0.94
R5114:Ada UTSW 2 163730486 missense probably benign 0.15
R5424:Ada UTSW 2 163728125 nonsense probably null
R5753:Ada UTSW 2 163735398 missense probably benign 0.00
R6392:Ada UTSW 2 163728217 missense probably damaging 1.00
R6501:Ada UTSW 2 163728188 unclassified probably null
R6646:Ada UTSW 2 163735423 missense probably benign
Z1088:Ada UTSW 2 163728116 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGACAGCAATGCCTGCTTC -3'
(R):5'- GGGACATGGTTATCACACCATCGAG -3'

Sequencing Primer
(F):5'- TTCCCAGCCAGTCAGAGTG -3'
(R):5'- CATCGAGGATGAAGCTCTCTAC -3'
Posted On2013-07-30