Incidental Mutation 'R0701:Gm13088'
ID63004
Institutional Source Beutler Lab
Gene Symbol Gm13088
Ensembl Gene ENSMUSG00000078513
Gene Namepredicted gene 13088
Synonyms
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0701 (G1)
Quality Score118
Status Not validated
Chromosome4
Chromosomal Location143653760-143657246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143656440 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 70 (E70K)
Ref Sequence ENSEMBL: ENSMUSP00000101397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105771
AA Change: E70K

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101397
Gene: ENSMUSG00000078513
AA Change: E70K

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 372 391 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Gm13088
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01418:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01551:Gm13088 APN 4 143656472 missense probably damaging 0.99
IGL02016:Gm13088 APN 4 143655319 missense possibly damaging 0.52
IGL02157:Gm13088 APN 4 143654377 missense probably damaging 1.00
IGL02433:Gm13088 APN 4 143655437 missense possibly damaging 0.92
IGL02726:Gm13088 APN 4 143655385 missense probably damaging 1.00
IGL02900:Gm13088 APN 4 143655515 missense possibly damaging 0.59
IGL03367:Gm13088 APN 4 143655623 missense possibly damaging 0.46
IGL02835:Gm13088 UTSW 4 143654247 missense probably damaging 1.00
R0141:Gm13088 UTSW 4 143654568 missense probably benign 0.01
R0166:Gm13088 UTSW 4 143654511 missense probably benign 0.00
R0197:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0365:Gm13088 UTSW 4 143655501 nonsense probably null
R0427:Gm13088 UTSW 4 143654423 missense probably benign 0.00
R0927:Gm13088 UTSW 4 143654220 missense possibly damaging 0.84
R1103:Gm13088 UTSW 4 143655372 missense probably damaging 1.00
R1163:Gm13088 UTSW 4 143656634 missense probably damaging 1.00
R1565:Gm13088 UTSW 4 143655617 nonsense probably null
R1588:Gm13088 UTSW 4 143655551 missense probably damaging 1.00
R1669:Gm13088 UTSW 4 143654346 missense possibly damaging 0.53
R1925:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R1929:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R1990:Gm13088 UTSW 4 143654268 missense probably damaging 1.00
R2272:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R2845:Gm13088 UTSW 4 143654298 missense probably damaging 0.99
R3819:Gm13088 UTSW 4 143655795 missense probably benign 0.02
R4660:Gm13088 UTSW 4 143654277 missense probably benign 0.01
R4857:Gm13088 UTSW 4 143656588 missense possibly damaging 0.65
R4888:Gm13088 UTSW 4 143654401 missense probably benign 0.33
R5004:Gm13088 UTSW 4 143654136 missense probably benign
R5242:Gm13088 UTSW 4 143655611 missense probably benign 0.38
R5246:Gm13088 UTSW 4 143655557 missense probably benign 0.00
R5596:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R5735:Gm13088 UTSW 4 143654635 missense probably damaging 1.00
R5841:Gm13088 UTSW 4 143655539 missense possibly damaging 0.95
R5982:Gm13088 UTSW 4 143654464 missense probably damaging 0.99
R6052:Gm13088 UTSW 4 143655652 missense probably damaging 1.00
R6169:Gm13088 UTSW 4 143654115 missense probably benign 0.04
R6403:Gm13088 UTSW 4 143655773 nonsense probably null
R6584:Gm13088 UTSW 4 143655470 missense possibly damaging 0.74
R6898:Gm13088 UTSW 4 143655483 missense probably damaging 1.00
X0021:Gm13088 UTSW 4 143655748 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCAAGAGGGGCATCTTTAATCCTG -3'
(R):5'- CTCAAGGACCTGCCCAATATGCTG -3'

Sequencing Primer
(F):5'- ATGCAGGTGTAGCCCATTC -3'
(R):5'- GCCCAATATGCTGTTCCCAG -3'
Posted On2013-07-30