Incidental Mutation 'R0701:Haus3'
ID63006
Institutional Source Beutler Lab
Gene Symbol Haus3
Ensembl Gene ENSMUSG00000079555
Gene NameHAUS augmin-like complex, subunit 3
SynonymsD5H4S43, D4S43h, D5H4S43E
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0701 (G1)
Quality Score95
Status Not validated
Chromosome5
Chromosomal Location34153880-34169527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34166015 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 417 (T417M)
Ref Sequence ENSEMBL: ENSMUSP00000049973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000060049] [ENSMUST00000202042] [ENSMUST00000202409] [ENSMUST00000202541] [ENSMUST00000202638]
Predicted Effect probably benign
Transcript: ENSMUST00000042954
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060049
AA Change: T417M

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000049973
Gene: ENSMUSG00000079555
AA Change: T417M

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 282 4.8e-85 PFAM
coiled coil region 294 336 N/A INTRINSIC
coiled coil region 459 495 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201069
Predicted Effect probably benign
Transcript: ENSMUST00000202042
SMART Domains Protein: ENSMUSP00000144049
Gene: ENSMUSG00000079555

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 96 7.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202290
Predicted Effect probably benign
Transcript: ENSMUST00000202409
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202541
Predicted Effect probably benign
Transcript: ENSMUST00000202638
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the HAUS augmin-like protein complex, which plays a key role in cytokinesis and mitosis. Disruption of the encoded protein causes mitotic defects resulting from fragmentation of centrosomes and microtubule destabilization. This gene shares its 5' exons with some transcripts from overlapping GeneID: 353497, which encodes a DNA polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit pre- or peri-implantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Haus3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Haus3 APN 5 34167928 missense probably benign 0.00
IGL00990:Haus3 APN 5 34166346 missense probably benign 0.00
IGL01311:Haus3 APN 5 34167644 nonsense probably null
IGL01906:Haus3 APN 5 34168323 intron probably benign
IGL01964:Haus3 APN 5 34166061 missense probably benign 0.19
IGL02383:Haus3 APN 5 34166236 nonsense probably null
IGL02584:Haus3 APN 5 34166258 nonsense probably null
IGL02800:Haus3 APN 5 34166324 missense possibly damaging 0.94
IGL03010:Haus3 APN 5 34166287 missense probably benign 0.04
IGL03371:Haus3 APN 5 34166343 nonsense probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R1527:Haus3 UTSW 5 34154053 missense probably benign 0.00
R1714:Haus3 UTSW 5 34163697 missense probably benign 0.03
R1800:Haus3 UTSW 5 34163572 missense probably damaging 1.00
R4874:Haus3 UTSW 5 34167628 missense probably benign 0.07
R4895:Haus3 UTSW 5 34168070 missense probably benign 0.33
R5268:Haus3 UTSW 5 34166105 missense probably damaging 0.98
R5613:Haus3 UTSW 5 34167829 missense probably damaging 0.98
R6299:Haus3 UTSW 5 34167796 missense probably benign 0.40
R6701:Haus3 UTSW 5 34167734 missense probably damaging 0.99
R7414:Haus3 UTSW 5 34166133 missense probably benign
X0019:Haus3 UTSW 5 34163556 nonsense probably null
X0063:Haus3 UTSW 5 34166222 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCCGATACAATCAGTATCATGCCCAG -3'
(R):5'- CAGTTGTAAAGGGCGATTTTGAACTGC -3'

Sequencing Primer
(F):5'- TGACTTCAGCTCTAAAGTGGC -3'
(R):5'- GGCATCTTTTGAGCTTGTCCAG -3'
Posted On2013-07-30