Incidental Mutation 'R0701:Cald1'
ID63008
Institutional Source Beutler Lab
Gene Symbol Cald1
Ensembl Gene ENSMUSG00000029761
Gene Namecaldesmon 1
Synonyms4833423D12Rik, C920027I18Rik
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0701 (G1)
Quality Score109
Status Not validated
Chromosome6
Chromosomal Location34598500-34775473 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAGAGAGAGAGAGAG to AAGAGAGAGAGAG at 34746173 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031775] [ENSMUST00000079391] [ENSMUST00000115021] [ENSMUST00000115026] [ENSMUST00000115027] [ENSMUST00000126181] [ENSMUST00000142512] [ENSMUST00000149009]
Predicted Effect probably benign
Transcript: ENSMUST00000031775
SMART Domains Protein: ENSMUSP00000031775
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 542 5.7e-256 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079391
SMART Domains Protein: ENSMUSP00000078362
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 522 4.3e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115021
SMART Domains Protein: ENSMUSP00000110673
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 518 7.5e-259 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115026
SMART Domains Protein: ENSMUSP00000110678
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 524 4.9e-259 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115027
SMART Domains Protein: ENSMUSP00000110679
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 363 8.4e-34 PFAM
Pfam:Caldesmon 243 755 3.8e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123823
SMART Domains Protein: ENSMUSP00000117064
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 210 4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126181
SMART Domains Protein: ENSMUSP00000121911
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 138 7.6e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136907
SMART Domains Protein: ENSMUSP00000121213
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 50 354 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142512
SMART Domains Protein: ENSMUSP00000122926
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 253 9.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142716
SMART Domains Protein: ENSMUSP00000116247
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 274 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146685
Predicted Effect probably benign
Transcript: ENSMUST00000149009
SMART Domains Protein: ENSMUSP00000138368
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 507 2e-247 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154182
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Some homozygous mutant mice develop hernia and those that do, die within 5-7 hours after birth. Mice homozygous for a different targeted allele fail to develop. Mice heterozygous for this allele exhibit increased urinary bladder weight, smooth muscle bundles and non-voiding contractions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Csad A G 15: 102,179,136 S331P probably benign Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Cald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cald1 APN 6 34762261 missense possibly damaging 0.66
IGL01456:Cald1 APN 6 34764996 missense probably damaging 1.00
IGL01822:Cald1 APN 6 34753572 missense probably damaging 0.99
IGL01959:Cald1 APN 6 34753468 missense probably damaging 1.00
IGL02307:Cald1 APN 6 34753455 missense probably damaging 1.00
IGL03122:Cald1 APN 6 34765028 missense probably damaging 1.00
R0060:Cald1 UTSW 6 34715459 intron probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0776:Cald1 UTSW 6 34746173 frame shift probably null
R1053:Cald1 UTSW 6 34755642 missense probably damaging 1.00
R1696:Cald1 UTSW 6 34745711 missense probably damaging 1.00
R2025:Cald1 UTSW 6 34746173 frame shift probably null
R2157:Cald1 UTSW 6 34686041 missense possibly damaging 0.86
R2973:Cald1 UTSW 6 34757996 unclassified probably benign
R3839:Cald1 UTSW 6 34745765 missense probably damaging 1.00
R4116:Cald1 UTSW 6 34745719 missense probably damaging 1.00
R4674:Cald1 UTSW 6 34746173 frame shift probably null
R5140:Cald1 UTSW 6 34753580 missense probably damaging 1.00
R5254:Cald1 UTSW 6 34746416 intron probably benign
R5620:Cald1 UTSW 6 34762112 missense probably damaging 1.00
R5648:Cald1 UTSW 6 34762332 splice site probably null
R5651:Cald1 UTSW 6 34762320 missense probably damaging 0.98
R5783:Cald1 UTSW 6 34753533 missense possibly damaging 0.51
R5872:Cald1 UTSW 6 34771108 nonsense probably null
R5999:Cald1 UTSW 6 34746338 intron probably benign
R6218:Cald1 UTSW 6 34747928 frame shift probably null
R6347:Cald1 UTSW 6 34765046 missense probably damaging 1.00
R6598:Cald1 UTSW 6 34746640 critical splice donor site probably null
R7120:Cald1 UTSW 6 34686076 critical splice donor site probably null
R7147:Cald1 UTSW 6 34746296 missense
R7385:Cald1 UTSW 6 34686065 missense probably damaging 0.99
R7516:Cald1 UTSW 6 34709557 start gained probably benign
X0064:Cald1 UTSW 6 34746205 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTCATCAAGTCCTACCAGAAGAAC -3'
(R):5'- CACAGTGCTTACTGTACCTGCGTC -3'

Sequencing Primer
(F):5'- CAGCTATCAGGATGCTGAAGAC -3'
(R):5'- cctccctcctctctctctc -3'
Posted On2013-07-30