Incidental Mutation 'R0701:Csad'
ID63030
Institutional Source Beutler Lab
Gene Symbol Csad
Ensembl Gene ENSMUSG00000023044
Gene Namecysteine sulfinic acid decarboxylase
Synonyms
MMRRC Submission 038884-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0701 (G1)
Quality Score129
Status Not validated
Chromosome15
Chromosomal Location102176999-102204724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102179136 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 331 (S331P)
Ref Sequence ENSEMBL: ENSMUSP00000155492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023805] [ENSMUST00000230288] [ENSMUST00000230322] [ENSMUST00000230708] [ENSMUST00000231048]
Predicted Effect probably benign
Transcript: ENSMUST00000023805
AA Change: S331P

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023805
Gene: ENSMUSG00000023044
AA Change: S331P

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 49 417 1.4e-113 PFAM
Pfam:Aminotran_5 120 281 4.9e-7 PFAM
low complexity region 482 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230253
Predicted Effect probably benign
Transcript: ENSMUST00000230288
AA Change: S331P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000230322
Predicted Effect probably benign
Transcript: ENSMUST00000230342
Predicted Effect probably benign
Transcript: ENSMUST00000230708
Predicted Effect probably benign
Transcript: ENSMUST00000231029
Predicted Effect probably benign
Transcript: ENSMUST00000231048
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,730,075 V261A probably benign Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Arhgef11 G T 3: 87,733,459 A1308S probably benign Het
Bach1 G A 16: 87,719,989 E473K probably damaging Het
Bsph1 G T 7: 13,472,256 C72F probably damaging Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
C9 A C 15: 6,467,421 T200P probably damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Copg1 T A 6: 87,894,107 Y268* probably null Het
Ddx31 G T 2: 28,858,777 R239L probably null Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Fig4 T A 10: 41,240,512 R628* probably null Het
Fmnl3 T C 15: 99,321,307 N778S probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Haus3 G A 5: 34,166,015 T417M probably benign Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Hoxb3 C A 11: 96,346,248 S384* probably null Het
Ifnar2 A G 16: 91,404,229 T453A possibly damaging Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Lrriq1 A T 10: 103,234,044 V37E probably benign Het
Lrrn4 G A 2: 132,870,160 T581M probably benign Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Mdn1 T A 4: 32,699,263 D1313E probably benign Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Mlh3 A T 12: 85,267,903 I503K probably benign Het
Nckap5 A G 1: 126,025,357 F1089L probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr395 A T 11: 73,906,829 I221N probably damaging Het
Pdgfd A T 9: 6,359,706 D259V probably damaging Het
R3hdm1 A G 1: 128,181,739 Y309C probably damaging Het
Rab27b A T 18: 69,985,199 C216S probably damaging Het
Robo2 A G 16: 74,046,874 I151T probably damaging Het
Sh2d4a A G 8: 68,331,095 D227G probably damaging Het
Sis G T 3: 72,941,045 T632K probably damaging Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Stap1 T C 5: 86,094,808 probably null Het
Syt16 G A 12: 74,235,112 V337I probably benign Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Ttn A G 2: 76,898,068 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp6nl A G 2: 6,415,018 E144G possibly damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zap70 G A 1: 36,781,177 R513Q probably damaging Het
Other mutations in Csad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Csad APN 15 102187163 missense probably damaging 1.00
IGL01769:Csad APN 15 102180081 missense probably benign 0.02
IGL02254:Csad APN 15 102186437 nonsense probably null
dejavu UTSW 15 102179972 missense probably damaging 1.00
dell UTSW 15 102178606 missense probably damaging 1.00
lenovo UTSW 15 102179034 missense probably null 1.00
PIT4382001:Csad UTSW 15 102188650 missense probably benign 0.00
R1595:Csad UTSW 15 102177782 missense probably damaging 1.00
R1707:Csad UTSW 15 102179972 missense probably damaging 1.00
R2107:Csad UTSW 15 102179034 missense probably null 1.00
R2196:Csad UTSW 15 102187593 missense probably benign 0.00
R2275:Csad UTSW 15 102187122 missense probably damaging 0.98
R2504:Csad UTSW 15 102188667 start codon destroyed probably null 0.97
R2928:Csad UTSW 15 102177704 missense probably damaging 1.00
R3924:Csad UTSW 15 102178556 missense probably benign 0.05
R6235:Csad UTSW 15 102178606 missense probably damaging 1.00
R6418:Csad UTSW 15 102179523 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTTCATGCTTACCGGGTGAGAG -3'
(R):5'- TGGGACACGGACAGATGATTGATTTTG -3'

Sequencing Primer
(F):5'- CTTACCGGGTGAGAGCAAAG -3'
(R):5'- TCCATGTGCCCAGGGAATTG -3'
Posted On2013-07-30