Incidental Mutation 'R0702:Olfr199'
ID63065
Institutional Source Beutler Lab
Gene Symbol Olfr199
Ensembl Gene ENSMUSG00000074996
Gene Nameolfactory receptor 199
SynonymsGA_x54KRFPKG5P-55430495-55429569, MOR182-14
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0702 (G1)
Quality Score151
Status Not validated
Chromosome16
Chromosomal Location59214134-59219767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59215699 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 305 (M305V)
Ref Sequence ENSEMBL: ENSMUSP00000150643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099657] [ENSMUST00000214186]
Predicted Effect probably benign
Transcript: ENSMUST00000099657
AA Change: M305V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097249
Gene: ENSMUSG00000074996
AA Change: M305V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.6e-6 PFAM
Pfam:7tm_1 41 290 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214186
AA Change: M305V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Olfr199
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr199 APN 16 59216496 missense probably damaging 0.97
IGL00972:Olfr199 APN 16 59216466 missense probably damaging 1.00
IGL01734:Olfr199 APN 16 59216429 missense probably benign 0.12
IGL01876:Olfr199 APN 16 59216019 missense possibly damaging 0.89
IGL02017:Olfr199 APN 16 59215947 missense probably damaging 1.00
IGL02871:Olfr199 APN 16 59216374 nonsense probably null
IGL03153:Olfr199 APN 16 59216203 missense probably benign 0.35
R0825:Olfr199 UTSW 16 59216450 missense possibly damaging 0.70
R1522:Olfr199 UTSW 16 59215984 missense probably damaging 1.00
R1769:Olfr199 UTSW 16 59215981 missense probably benign 0.01
R2144:Olfr199 UTSW 16 59216026 missense probably benign 0.00
R3956:Olfr199 UTSW 16 59216065 nonsense probably null
R4783:Olfr199 UTSW 16 59215859 missense probably damaging 0.98
R5534:Olfr199 UTSW 16 59216040 missense probably benign 0.39
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6031:Olfr199 UTSW 16 59215933 missense probably benign 0.00
R6141:Olfr199 UTSW 16 59216553 missense probably benign
R6445:Olfr199 UTSW 16 59216109 missense probably damaging 1.00
R6459:Olfr199 UTSW 16 59216020 missense probably benign 0.44
R6568:Olfr199 UTSW 16 59216278 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGTGCTACCAGAACGTCACTGAACC -3'
(R):5'- AAAGCCTTCTCCACATGCAGTGCC -3'

Sequencing Primer
(F):5'- CGTCACTGAACCTACATGATTGG -3'
(R):5'- ACATGCAGTGCCCATCTACTC -3'
Posted On2013-07-30