Incidental Mutation 'R0704:Mef2a'
ID63092
Institutional Source Beutler Lab
Gene Symbol Mef2a
Ensembl Gene ENSMUSG00000030557
Gene Namemyocyte enhancer factor 2A
SynonymsA430079H05Rik
MMRRC Submission 038887-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0704 (G1)
Quality Score138
Status Not validated
Chromosome7
Chromosomal Location67231163-67372858 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 67235148 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 406 (S406*)
Ref Sequence ENSEMBL: ENSMUSP00000117496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032776] [ENSMUST00000072460] [ENSMUST00000076325] [ENSMUST00000107476] [ENSMUST00000135493] [ENSMUST00000156690] [ENSMUST00000207715] [ENSMUST00000208512]
Predicted Effect probably null
Transcript: ENSMUST00000032776
AA Change: S400*
SMART Domains Protein: ENSMUSP00000032776
Gene: ENSMUSG00000030557
AA Change: S400*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072460
SMART Domains Protein: ENSMUSP00000138645
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076325
AA Change: S400*
SMART Domains Protein: ENSMUSP00000075664
Gene: ENSMUSG00000030557
AA Change: S400*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107476
AA Change: S398*
SMART Domains Protein: ENSMUSP00000103100
Gene: ENSMUSG00000030557
AA Change: S398*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 410 429 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135493
AA Change: S406*
SMART Domains Protein: ENSMUSP00000138566
Gene: ENSMUSG00000030557
AA Change: S406*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156690
AA Change: S406*
SMART Domains Protein: ENSMUSP00000117496
Gene: ENSMUSG00000030557
AA Change: S406*

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 152 1.3e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207794
Predicted Effect probably benign
Transcript: ENSMUST00000208512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208569
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Inactivation of this gene results in cardiac sudden death. Mice dying in the early postnatal period exhibit ventricular dilation, while mice dying in adulthood show a reduced number of mitochondria in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,210,083 V1256A possibly damaging Het
4930433I11Rik T A 7: 40,993,957 L441Q probably damaging Het
Abca15 A T 7: 120,354,523 E550V probably damaging Het
Adcy4 A G 14: 55,772,756 F690L probably benign Het
Aspg T A 12: 112,114,472 N132K probably damaging Het
B430305J03Rik A T 3: 61,363,993 Y110* probably null Het
Cep135 A G 5: 76,630,949 E741G possibly damaging Het
Dkkl1 T C 7: 45,210,115 K128E probably damaging Het
Duox2 A T 2: 122,284,768 M1101K probably benign Het
Gpr89 T C 3: 96,880,168 probably null Het
Hormad1 T C 3: 95,566,686 probably null Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Itga2 A G 13: 114,862,375 F658S possibly damaging Het
Kcnc4 T C 3: 107,447,963 I390V possibly damaging Het
Krt84 G T 15: 101,532,677 H27N probably benign Het
Lama5 A G 2: 180,179,484 I3095T possibly damaging Het
Ms4a1 T C 19: 11,253,232 T202A probably benign Het
Nrbp2 A G 15: 76,088,952 S294P probably damaging Het
Olfr524 A G 7: 140,202,635 V45A probably benign Het
Olfr811 A G 10: 129,802,303 V74A probably benign Het
Pde4b C T 4: 102,487,392 L155F probably damaging Het
Pds5a A G 5: 65,620,585 S6P probably damaging Het
Ralgapa2 A T 2: 146,451,784 L150Q probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Rgs12 T G 5: 35,023,122 S253A possibly damaging Het
Sap130 C A 18: 31,653,554 T266K probably damaging Het
Sis T C 3: 72,949,822 I379V possibly damaging Het
Slc39a10 T A 1: 46,835,861 I94F possibly damaging Het
Sptb A T 12: 76,583,594 N2263K probably damaging Het
Srsf12 A G 4: 33,231,069 R188G probably damaging Het
Ssxb9 T G X: 8,371,783 S130R probably damaging Het
Tg A G 15: 66,757,880 D470G probably benign Het
Urb1 T C 16: 90,776,207 Q979R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp78 T A 7: 6,379,252 C402S probably damaging Het
Other mutations in Mef2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Mef2a APN 7 67264872 missense probably damaging 0.98
IGL02112:Mef2a APN 7 67264872 missense probably damaging 0.98
P0024:Mef2a UTSW 7 67295574 missense probably damaging 1.00
R0390:Mef2a UTSW 7 67251724 missense probably damaging 0.96
R0583:Mef2a UTSW 7 67235148 nonsense probably null
R0584:Mef2a UTSW 7 67235148 nonsense probably null
R0589:Mef2a UTSW 7 67235148 nonsense probably null
R0597:Mef2a UTSW 7 67235148 nonsense probably null
R0608:Mef2a UTSW 7 67235148 nonsense probably null
R1859:Mef2a UTSW 7 67266018 missense probably damaging 0.97
R2166:Mef2a UTSW 7 67266122 missense probably damaging 1.00
R2427:Mef2a UTSW 7 67266060 missense probably damaging 0.98
R3618:Mef2a UTSW 7 67268327 missense probably benign 0.34
R3619:Mef2a UTSW 7 67268327 missense probably benign 0.34
R4576:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4577:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4578:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4635:Mef2a UTSW 7 67240427 missense possibly damaging 0.67
R5805:Mef2a UTSW 7 67251668 missense possibly damaging 0.89
X0011:Mef2a UTSW 7 67235164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAACCAGGAAGCCTTAGGTCAC -3'
(R):5'- TTAGGCCCTCAGTCTTCTCAGACAG -3'

Sequencing Primer
(F):5'- CCTCATGCGTTTTACAGAAGG -3'
(R):5'- CAGACAGTTTCCTGAGCTTTG -3'
Posted On2013-07-30