Incidental Mutation 'R0704:Abca15'
ID63093
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
MMRRC Submission 038887-MU
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0704 (G1)
Quality Score123
Status Not validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120354523 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 550 (E550V)
Ref Sequence ENSEMBL: ENSMUSP00000075621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect probably damaging
Transcript: ENSMUST00000076272
AA Change: E550V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: E550V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121265
AA Change: E550V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: E550V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140459
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,210,083 V1256A possibly damaging Het
4930433I11Rik T A 7: 40,993,957 L441Q probably damaging Het
Adcy4 A G 14: 55,772,756 F690L probably benign Het
Aspg T A 12: 112,114,472 N132K probably damaging Het
B430305J03Rik A T 3: 61,363,993 Y110* probably null Het
Cep135 A G 5: 76,630,949 E741G possibly damaging Het
Dkkl1 T C 7: 45,210,115 K128E probably damaging Het
Duox2 A T 2: 122,284,768 M1101K probably benign Het
Gpr89 T C 3: 96,880,168 probably null Het
Hormad1 T C 3: 95,566,686 probably null Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Itga2 A G 13: 114,862,375 F658S possibly damaging Het
Kcnc4 T C 3: 107,447,963 I390V possibly damaging Het
Krt84 G T 15: 101,532,677 H27N probably benign Het
Lama5 A G 2: 180,179,484 I3095T possibly damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Ms4a1 T C 19: 11,253,232 T202A probably benign Het
Nrbp2 A G 15: 76,088,952 S294P probably damaging Het
Olfr524 A G 7: 140,202,635 V45A probably benign Het
Olfr811 A G 10: 129,802,303 V74A probably benign Het
Pde4b C T 4: 102,487,392 L155F probably damaging Het
Pds5a A G 5: 65,620,585 S6P probably damaging Het
Ralgapa2 A T 2: 146,451,784 L150Q probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Rgs12 T G 5: 35,023,122 S253A possibly damaging Het
Sap130 C A 18: 31,653,554 T266K probably damaging Het
Sis T C 3: 72,949,822 I379V possibly damaging Het
Slc39a10 T A 1: 46,835,861 I94F possibly damaging Het
Sptb A T 12: 76,583,594 N2263K probably damaging Het
Srsf12 A G 4: 33,231,069 R188G probably damaging Het
Ssxb9 T G X: 8,371,783 S130R probably damaging Het
Tg A G 15: 66,757,880 D470G probably benign Het
Urb1 T C 16: 90,776,207 Q979R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp78 T A 7: 6,379,252 C402S probably damaging Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCCTTCAAAAacacacatgcacacac -3'
(R):5'- AGAACTCGAAAACAAAGCAGCCTATTAAACTA -3'

Sequencing Primer
(F):5'- gttcctgcctcccacattc -3'
(R):5'- GCAGCCTATTAAACTATGTCATGC -3'
Protein Function and Prediction

Abca15 encodes ABCA15, a member of the ATP-binding cassette (ABC) transporter superfamily.  The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations. Abca15 has been cloned rat and mouse; no human orthologue has been described. The ABCA15 has two nucleotide-binding folds and two transmembrane domains.  Abca15 is predominantly expressed in testis, indicating that it may function in testicular development or spermatogenesis. 

Posted On2013-07-30