Incidental Mutation 'R0704:Olfr811'
ID63096
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission 038887-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0704 (G1)
Quality Score134
Status Not validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129802303 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably benign
Transcript: ENSMUST00000076437
AA Change: V74A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: V74A

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215058
AA Change: V74A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably benign
Transcript: ENSMUST00000217571
AA Change: V74A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,210,083 V1256A possibly damaging Het
4930433I11Rik T A 7: 40,993,957 L441Q probably damaging Het
Abca15 A T 7: 120,354,523 E550V probably damaging Het
Adcy4 A G 14: 55,772,756 F690L probably benign Het
Aspg T A 12: 112,114,472 N132K probably damaging Het
B430305J03Rik A T 3: 61,363,993 Y110* probably null Het
Cep135 A G 5: 76,630,949 E741G possibly damaging Het
Dkkl1 T C 7: 45,210,115 K128E probably damaging Het
Duox2 A T 2: 122,284,768 M1101K probably benign Het
Gpr89 T C 3: 96,880,168 probably null Het
Hormad1 T C 3: 95,566,686 probably null Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Itga2 A G 13: 114,862,375 F658S possibly damaging Het
Kcnc4 T C 3: 107,447,963 I390V possibly damaging Het
Krt84 G T 15: 101,532,677 H27N probably benign Het
Lama5 A G 2: 180,179,484 I3095T possibly damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Ms4a1 T C 19: 11,253,232 T202A probably benign Het
Nrbp2 A G 15: 76,088,952 S294P probably damaging Het
Olfr524 A G 7: 140,202,635 V45A probably benign Het
Pde4b C T 4: 102,487,392 L155F probably damaging Het
Pds5a A G 5: 65,620,585 S6P probably damaging Het
Ralgapa2 A T 2: 146,451,784 L150Q probably damaging Het
Reln C T 5: 21,896,811 V3374I probably damaging Het
Rgs12 T G 5: 35,023,122 S253A possibly damaging Het
Sap130 C A 18: 31,653,554 T266K probably damaging Het
Sis T C 3: 72,949,822 I379V possibly damaging Het
Slc39a10 T A 1: 46,835,861 I94F possibly damaging Het
Sptb A T 12: 76,583,594 N2263K probably damaging Het
Srsf12 A G 4: 33,231,069 R188G probably damaging Het
Ssxb9 T G X: 8,371,783 S130R probably damaging Het
Tg A G 15: 66,757,880 D470G probably benign Het
Urb1 T C 16: 90,776,207 Q979R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp78 T A 7: 6,379,252 C402S probably damaging Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R1393:Olfr811 UTSW 10 129801932 missense probably benign 0.22
R1941:Olfr811 UTSW 10 129802412 missense probably benign 0.00
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R5750:Olfr811 UTSW 10 129801620 missense probably benign 0.01
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6109:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6440:Olfr811 UTSW 10 129801968 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGCAAGACAGTTGCAGGAG -3'
(R):5'- TTTGCTTGGTCTGACAGATGACCC -3'

Sequencing Primer
(F):5'- TCTAGTTTGAGTCCCAAGAGC -3'
(R):5'- GTCTGACAGATGACCCTCAGC -3'
Posted On2013-07-30