Incidental Mutation 'R0707:Cog6'
ID63150
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Namecomponent of oligomeric golgi complex 6
Synonyms
MMRRC Submission 038890-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0707 (G1)
Quality Score201
Status Validated
Chromosome3
Chromosomal Location52981875-53017237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53013862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 108 (V108I)
Ref Sequence ENSEMBL: ENSMUSP00000141339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036665
AA Change: V108I

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: V108I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193043
Predicted Effect possibly damaging
Transcript: ENSMUST00000193432
AA Change: V108I

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: V108I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195183
SMART Domains Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:COG6 39 174 5.5e-32 PFAM
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,258,321 N2881K unknown Het
Acot11 A G 4: 106,760,132 F259S probably damaging Het
Aldh16a1 T A 7: 45,144,507 probably benign Het
Ankrd24 A T 10: 81,642,713 probably benign Het
Arhgap5 T C 12: 52,518,168 S641P probably damaging Het
Arpp21 A C 9: 112,157,756 S242R probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Ccdc65 G A 15: 98,709,214 V101I possibly damaging Het
Ccr7 T A 11: 99,145,983 T38S probably damaging Het
Cdc14a T C 3: 116,293,713 probably benign Het
Ces2f C T 8: 104,950,986 H208Y possibly damaging Het
Chst1 C A 2: 92,613,619 N145K possibly damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Dicer1 A T 12: 104,706,885 F792I probably damaging Het
Dnajc13 T C 9: 104,172,582 K1780R probably benign Het
Dph5 A C 3: 115,915,133 N155H probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Etl4 C A 2: 20,805,571 probably benign Het
Flt3l T C 7: 45,136,026 S9G probably benign Het
Fmnl2 A G 2: 53,054,486 E159G possibly damaging Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Herc6 G A 6: 57,662,362 G905E possibly damaging Het
Hhip T A 8: 79,998,255 N296I probably damaging Het
Hmgcr A T 13: 96,650,643 probably benign Het
Kalrn T G 16: 34,010,581 N723H possibly damaging Het
Mroh5 T A 15: 73,790,739 Y242F possibly damaging Het
Msh3 T A 13: 92,347,340 K258* probably null Het
Myo1a T C 10: 127,719,863 probably benign Het
Nlrp4f C T 13: 65,194,503 E443K probably benign Het
Nupr1l A G 5: 129,908,692 Y34C probably damaging Het
Ociad1 T C 5: 73,294,912 probably benign Het
Olfr1469 A T 19: 13,411,420 M284L probably benign Het
Olfr313 T A 11: 58,817,751 L248M probably damaging Het
Olfr366 A T 2: 37,220,196 K236* probably null Het
Olfr467 A G 7: 107,815,124 D182G probably damaging Het
Olfr522 T C 7: 140,162,089 N287S probably damaging Het
P2ry12 C A 3: 59,217,487 V256F probably damaging Het
Pcdhb22 T A 18: 37,518,851 I124N probably damaging Het
Pcnt A G 10: 76,420,541 F622L probably damaging Het
Pfas A T 11: 68,998,037 N361K probably benign Het
Plod2 T G 9: 92,605,427 L600V possibly damaging Het
Pole T C 5: 110,298,988 Y631H probably damaging Het
Proser1 T C 3: 53,478,776 L693P probably damaging Het
Ptprd A G 4: 75,957,239 Y1195H probably damaging Het
Rbm27 T A 18: 42,326,026 probably null Het
Ric8a A G 7: 140,857,973 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scfd1 A T 12: 51,412,577 K307M probably damaging Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Smg7 T G 1: 152,870,757 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Syne3 A G 12: 104,969,360 L53P probably damaging Het
Tcea1 T A 1: 4,880,346 probably benign Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Trim25 A T 11: 88,999,738 T84S probably benign Het
Trip4 A T 9: 65,839,004 F537I possibly damaging Het
Uaca G A 9: 60,848,618 probably benign Het
Ugt2b34 T A 5: 86,892,899 Y388F possibly damaging Het
Vmn2r71 T C 7: 85,619,432 V281A probably benign Het
Vps13d A T 4: 145,155,932 D1030E probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Zfp296 A G 7: 19,579,736 D172G probably benign Het
Zfp977 C A 7: 42,580,534 C189F probably damaging Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52986425 missense probably benign 0.03
IGL01946:Cog6 APN 3 53002404 intron probably benign
IGL02122:Cog6 APN 3 52998342 missense probably benign 0.04
IGL02589:Cog6 APN 3 53007270 missense probably damaging 1.00
IGL02819:Cog6 APN 3 53009545 missense probably damaging 0.98
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0086:Cog6 UTSW 3 52993570 missense probably damaging 0.98
R0545:Cog6 UTSW 3 52996075 missense probably damaging 1.00
R0718:Cog6 UTSW 3 53010629 missense probably benign 0.35
R1169:Cog6 UTSW 3 53013844 missense probably benign 0.30
R1451:Cog6 UTSW 3 53009113 missense possibly damaging 0.78
R1891:Cog6 UTSW 3 52983180 missense probably benign
R2249:Cog6 UTSW 3 53000479 critical splice donor site probably null
R2264:Cog6 UTSW 3 52992911 nonsense probably null
R3745:Cog6 UTSW 3 52992819 missense probably benign 0.05
R4027:Cog6 UTSW 3 53002529 missense possibly damaging 0.95
R4230:Cog6 UTSW 3 52992808 missense probably benign 0.13
R4400:Cog6 UTSW 3 53012941 missense probably benign 0.11
R4551:Cog6 UTSW 3 52998320 missense probably damaging 1.00
R4866:Cog6 UTSW 3 53010598 missense probably benign 0.10
R5326:Cog6 UTSW 3 53013816 missense probably null 0.12
R6169:Cog6 UTSW 3 53007301 missense probably benign 0.03
R6273:Cog6 UTSW 3 52996052 missense probably damaging 1.00
R7169:Cog6 UTSW 3 52989966 missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52983189 missense probably benign 0.21
R7243:Cog6 UTSW 3 53002315 missense probably damaging 1.00
R7299:Cog6 UTSW 3 53002507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTGTTTGCGCTCTTCTGAAAACC -3'
(R):5'- CGTCCTGTTGCATGGAATTGCTCTC -3'

Sequencing Primer
(F):5'- GCTCTTCTGAAAACCGTAACG -3'
(R):5'- AAGCACTGGTTCATCTCAGC -3'
Posted On2013-07-30