Incidental Mutation 'R0707:Dnajc13'
ID63176
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
MMRRC Submission 038890-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R0707 (G1)
Quality Score116
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104172582 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1780 (K1780R)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably benign
Transcript: ENSMUST00000035170
AA Change: K1775R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: K1775R

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185927
Predicted Effect probably benign
Transcript: ENSMUST00000186788
AA Change: K1780R

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: K1780R

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188425
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,258,321 N2881K unknown Het
Acot11 A G 4: 106,760,132 F259S probably damaging Het
Aldh16a1 T A 7: 45,144,507 probably benign Het
Ankrd24 A T 10: 81,642,713 probably benign Het
Arhgap5 T C 12: 52,518,168 S641P probably damaging Het
Arpp21 A C 9: 112,157,756 S242R probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Ccdc65 G A 15: 98,709,214 V101I possibly damaging Het
Ccr7 T A 11: 99,145,983 T38S probably damaging Het
Cdc14a T C 3: 116,293,713 probably benign Het
Ces2f C T 8: 104,950,986 H208Y possibly damaging Het
Chst1 C A 2: 92,613,619 N145K possibly damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cog6 C T 3: 53,013,862 V108I possibly damaging Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Dicer1 A T 12: 104,706,885 F792I probably damaging Het
Dph5 A C 3: 115,915,133 N155H probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Etl4 C A 2: 20,805,571 probably benign Het
Flt3l T C 7: 45,136,026 S9G probably benign Het
Fmnl2 A G 2: 53,054,486 E159G possibly damaging Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Herc6 G A 6: 57,662,362 G905E possibly damaging Het
Hhip T A 8: 79,998,255 N296I probably damaging Het
Hmgcr A T 13: 96,650,643 probably benign Het
Kalrn T G 16: 34,010,581 N723H possibly damaging Het
Mroh5 T A 15: 73,790,739 Y242F possibly damaging Het
Msh3 T A 13: 92,347,340 K258* probably null Het
Myo1a T C 10: 127,719,863 probably benign Het
Nlrp4f C T 13: 65,194,503 E443K probably benign Het
Nupr1l A G 5: 129,908,692 Y34C probably damaging Het
Ociad1 T C 5: 73,294,912 probably benign Het
Olfr1469 A T 19: 13,411,420 M284L probably benign Het
Olfr313 T A 11: 58,817,751 L248M probably damaging Het
Olfr366 A T 2: 37,220,196 K236* probably null Het
Olfr467 A G 7: 107,815,124 D182G probably damaging Het
Olfr522 T C 7: 140,162,089 N287S probably damaging Het
P2ry12 C A 3: 59,217,487 V256F probably damaging Het
Pcdhb22 T A 18: 37,518,851 I124N probably damaging Het
Pcnt A G 10: 76,420,541 F622L probably damaging Het
Pfas A T 11: 68,998,037 N361K probably benign Het
Plod2 T G 9: 92,605,427 L600V possibly damaging Het
Pole T C 5: 110,298,988 Y631H probably damaging Het
Proser1 T C 3: 53,478,776 L693P probably damaging Het
Ptprd A G 4: 75,957,239 Y1195H probably damaging Het
Rbm27 T A 18: 42,326,026 probably null Het
Ric8a A G 7: 140,857,973 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scfd1 A T 12: 51,412,577 K307M probably damaging Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Smg7 T G 1: 152,870,757 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Syne3 A G 12: 104,969,360 L53P probably damaging Het
Tcea1 T A 1: 4,880,346 probably benign Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Trim25 A T 11: 88,999,738 T84S probably benign Het
Trip4 A T 9: 65,839,004 F537I possibly damaging Het
Uaca G A 9: 60,848,618 probably benign Het
Ugt2b34 T A 5: 86,892,899 Y388F possibly damaging Het
Vmn2r71 T C 7: 85,619,432 V281A probably benign Het
Vps13d A T 4: 145,155,932 D1030E probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Zfp296 A G 7: 19,579,736 D172G probably benign Het
Zfp977 C A 7: 42,580,534 C189F probably damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCACCCTGAATGACAGTGTCC -3'
(R):5'- TGCTATTTACGGCTTAACACCCTGC -3'

Sequencing Primer
(F):5'- ATGACAGTGTCCAGCATTTGC -3'
(R):5'- TGCACAGCTTCCAGATAGACG -3'
Posted On2013-07-30