Incidental Mutation 'R0011:Celsr2'
ID63207
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
MMRRC Submission 038306-MU
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0011 (G1)
Quality Score115
Status Validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108413402 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 698 (I698T)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
Predicted Effect probably benign
Transcript: ENSMUST00000090558
AA Change: I698T

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: I698T

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCACGTCATTCACCAGGATCTC -3'
(R):5'- CGCTCACAGTGTCATTACCTACCAG -3'

Sequencing Primer
(F):5'- GTATAAGACACCTGGTCCTCGTAG -3'
(R):5'- GTGTCATTACCTACCAGATCACCAG -3'
Posted On2013-07-30