Incidental Mutation 'R0042:P4hb'
ID63256
Institutional Source Beutler Lab
Gene Symbol P4hb
Ensembl Gene ENSMUSG00000025130
Gene Nameprolyl 4-hydroxylase, beta polypeptide
SynonymsThbp, protein disulfide isomerase, ERp59, PDI, Pdia1
MMRRC Submission 038336-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R0042 (G1)
Quality Score97
Status Validated
Chromosome11
Chromosomal Location120560298-120573253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120568266 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 134 (R134C)
Ref Sequence ENSEMBL: ENSMUSP00000026122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026122] [ENSMUST00000168360]
Predicted Effect probably damaging
Transcript: ENSMUST00000026122
AA Change: R134C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026122
Gene: ENSMUSG00000025130
AA Change: R134C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 134 4.9e-37 PFAM
Pfam:Thioredoxin_2 39 126 3.5e-9 PFAM
Pfam:Thioredoxin_6 163 347 8.3e-44 PFAM
Pfam:Thioredoxin 370 475 1.5e-30 PFAM
low complexity region 478 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168360
SMART Domains Protein: ENSMUSP00000128796
Gene: ENSMUSG00000025130

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 131 6e-32 PFAM
low complexity region 134 157 N/A INTRINSIC
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele and conditional allele activated in immune cells exhibit impaired neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik C A 17: 25,947,982 E194* probably null Het
Abca1 C T 4: 53,059,245 probably benign Het
Acr T A 15: 89,574,332 H405Q probably benign Het
Adad1 T C 3: 37,083,173 probably benign Het
Alox5ap T C 5: 149,279,259 probably benign Het
Ank2 T C 3: 126,936,631 D3568G probably damaging Het
Atl3 T G 19: 7,529,023 I306S probably damaging Het
Atr T A 9: 95,927,356 probably benign Het
Ccnb2 A G 9: 70,419,053 V34A probably benign Het
Cdh12 A C 15: 21,537,677 probably benign Het
Cib1 C T 7: 80,230,378 V45M probably benign Het
Col6a6 T C 9: 105,780,697 E772G possibly damaging Het
Dmxl1 C A 18: 49,864,035 T466K probably benign Het
Dym T C 18: 75,125,539 probably null Het
Enpp3 A C 10: 24,774,824 F805V probably damaging Het
Eya1 T C 1: 14,184,489 D373G probably damaging Het
Gpr179 C T 11: 97,334,931 V2133I probably benign Het
Grb10 G T 11: 11,936,798 H435Q probably damaging Het
Gzmm T C 10: 79,694,565 I190T probably benign Het
Helt T C 8: 46,292,396 Y150C probably damaging Het
Hrg A T 16: 22,961,136 probably benign Het
Il17ra T C 6: 120,472,125 probably benign Het
Inhbc A G 10: 127,357,433 I238T probably benign Het
Itgb3 A G 11: 104,667,140 T787A possibly damaging Het
Jakmip2 T G 18: 43,552,145 probably benign Het
Krt4 T G 15: 101,922,752 probably benign Het
Lgsn C T 1: 31,190,453 T85I probably benign Het
Metap1 C T 3: 138,472,157 V217I probably benign Het
Mib2 A T 4: 155,659,440 C48* probably null Het
Mroh4 T A 15: 74,610,305 I768F probably damaging Het
Npas3 T A 12: 54,048,841 D361E probably damaging Het
Obscn A G 11: 59,052,585 L4246P probably damaging Het
Olfr1097 A G 2: 86,890,491 I228T probably damaging Het
Olfr1251 A C 2: 89,667,454 V144G probably benign Het
Olfr860 A G 9: 19,845,779 M280T probably benign Het
Plcb3 T C 19: 6,966,420 D71G probably damaging Het
Prex2 T A 1: 11,080,081 V159E probably damaging Het
Prpsap1 T A 11: 116,479,656 K158N probably benign Het
Ptger1 G T 8: 83,668,166 V91L probably benign Het
Rdh10 T C 1: 16,108,036 probably benign Het
Rgs9bp C A 7: 35,585,033 R63L probably damaging Het
Slc13a5 A T 11: 72,259,114 V173E probably benign Het
Spata31 A T 13: 64,922,563 I842L probably benign Het
Stk32b A C 5: 37,716,748 D13E probably benign Het
Svep1 T C 4: 58,123,192 D708G possibly damaging Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Thbs1 A C 2: 118,122,877 D925A probably damaging Het
Tnr A T 1: 159,887,025 T825S probably benign Het
Ttc23l A C 15: 10,551,541 L33W probably damaging Het
Ttc39d T C 17: 80,215,950 Y13H probably benign Het
Vmn2r102 C A 17: 19,660,589 P64Q probably damaging Het
Vps11 G T 9: 44,356,291 Y341* probably null Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwce C T 19: 10,646,813 A356V probably benign Het
Other mutations in P4hb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:P4hb APN 11 120563818 missense probably benign 0.00
R0042:P4hb UTSW 11 120568266 missense probably damaging 1.00
R0362:P4hb UTSW 11 120563336 missense probably benign 0.04
R0597:P4hb UTSW 11 120568244 missense possibly damaging 0.53
R1458:P4hb UTSW 11 120562555 splice site probably benign
R1635:P4hb UTSW 11 120571616 missense probably damaging 0.97
R1750:P4hb UTSW 11 120562720 missense probably damaging 0.99
R1773:P4hb UTSW 11 120572726 missense probably damaging 1.00
R1856:P4hb UTSW 11 120563218 missense probably benign 0.23
R1874:P4hb UTSW 11 120562166 missense probably benign
R2014:P4hb UTSW 11 120562696 missense probably damaging 0.98
R2239:P4hb UTSW 11 120563282 missense probably damaging 1.00
R2331:P4hb UTSW 11 120568280 missense probably benign 0.00
R3935:P4hb UTSW 11 120562409 missense probably benign 0.20
R3936:P4hb UTSW 11 120562409 missense probably benign 0.20
R5601:P4hb UTSW 11 120571615 missense possibly damaging 0.90
R5893:P4hb UTSW 11 120571650 missense probably damaging 1.00
R6533:P4hb UTSW 11 120571643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCATCAATAGCCTCTGCTGCC -3'
(R):5'- TGAGTACCACGGTGTCCTCTTCTG -3'

Sequencing Primer
(F):5'- AACTGCTTGGCAGAGTCTGAC -3'
(R):5'- AGGCTGTAGCCAGTTCTCTA -3'
Posted On2013-07-30