Incidental Mutation 'R0102:Cfi'
ID63280
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0102 (G1)
Quality Score195
Status Validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129848767 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 90 (H90P)
Ref Sequence ENSEMBL: ENSMUSP00000142975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077918
AA Change: H90P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: H90P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200206
AA Change: H90P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952
AA Change: H90P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 synonymous probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCATGAGGGTGACCTGCCTAAAAC -3'
(R):5'- TGACAGCAAAGCATTTTGTGACCG -3'

Sequencing Primer
(F):5'- TGACCTGCCTAAAACTGGGG -3'
(R):5'- CGAAAGGATGGCCTATCACTTC -3'
Posted On2013-07-30