Incidental Mutation 'R0106:Ephb6'
ID63333
Institutional Source Beutler Lab
Gene Symbol Ephb6
Ensembl Gene ENSMUSG00000029869
Gene NameEph receptor B6
SynonymsCekl, Mep
MMRRC Submission 038392-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R0106 (G1)
Quality Score89
Status Validated
Chromosome6
Chromosomal Location41605482-41620509 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 41619594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably benign
Transcript: ENSMUST00000031902
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194405
Predicted Effect probably benign
Transcript: ENSMUST00000201471
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,415,194 noncoding transcript Het
Abcb9 T C 5: 124,083,060 N276S possibly damaging Het
Arhgef25 A G 10: 127,184,010 probably null Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Aspm C A 1: 139,476,876 Q1315K probably benign Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
BC055324 T C 1: 163,982,811 probably benign Het
Brf1 A G 12: 112,973,463 probably benign Het
Card19 A C 13: 49,208,145 D3E probably benign Het
Chd6 A G 2: 160,967,902 F1480L probably damaging Het
Ckap5 T C 2: 91,578,205 I915T possibly damaging Het
Ckap5 T A 2: 91,615,840 I1836N probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Cramp1l A G 17: 24,972,376 V1037A probably benign Het
Cspg5 C A 9: 110,246,532 P112Q probably damaging Het
Cyp2g1 T A 7: 26,814,182 I182N probably damaging Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Fkbp6 C T 5: 135,340,004 R234Q probably benign Het
Gda T C 19: 21,397,556 D332G probably benign Het
Ggt7 C T 2: 155,494,893 A560T possibly damaging Het
Glis3 A T 19: 28,531,868 S239T possibly damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hsdl1 T A 8: 119,565,778 S254C probably damaging Het
Igsf6 T A 7: 121,074,454 I18F probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kif13a G T 13: 46,825,347 probably benign Het
Kif14 T C 1: 136,479,924 probably benign Het
L2hgdh A T 12: 69,705,789 Y239* probably null Het
Lama3 T C 18: 12,403,982 V228A probably damaging Het
Lamp1 A G 8: 13,174,550 T405A probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk12 T C 15: 89,132,984 probably benign Het
Mdga2 A T 12: 66,716,706 N205K probably damaging Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nat10 A G 2: 103,757,205 V55A probably damaging Het
Nlrp10 T C 7: 108,925,322 E317G possibly damaging Het
Nomo1 T C 7: 46,037,632 I72T probably damaging Het
Olfr1450 A G 19: 12,954,356 I256V probably benign Het
Olfr974 GC G 9: 39,942,823 probably null Het
Pappa2 C T 1: 158,714,977 C1780Y probably damaging Het
Pgm2l1 A G 7: 100,250,373 M65V probably benign Het
Plec C T 15: 76,176,318 E3162K probably damaging Het
Pnisr T C 4: 21,874,617 probably benign Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Prss34 A T 17: 25,298,726 D25V probably damaging Het
Ptpn1 T C 2: 167,976,418 probably benign Het
Pygb A G 2: 150,806,203 D119G probably benign Het
Racgap1 T C 15: 99,642,958 T4A possibly damaging Het
Rap1gap2 A G 11: 74,435,744 C166R probably benign Het
Rbm28 C A 6: 29,127,803 V705L probably benign Het
Rgs1 C T 1: 144,248,549 V50M probably benign Het
Rgs12 C T 5: 34,966,664 T597I probably benign Het
Ros1 T C 10: 52,142,267 N765S possibly damaging Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scube2 A G 7: 109,846,908 probably benign Het
Serpinb10 T A 1: 107,546,744 L212Q probably damaging Het
Slc6a7 A G 18: 61,002,223 V411A probably benign Het
Slco1a6 A T 6: 142,157,390 probably benign Het
Smc1b A T 15: 85,070,819 D1077E probably damaging Het
Srek1 G A 13: 103,743,623 H476Y unknown Het
Strn3 A G 12: 51,621,788 V673A probably benign Het
Tepsin T C 11: 120,091,811 probably null Het
Timmdc1 A C 16: 38,522,362 L58R probably damaging Het
Tmem132c T C 5: 127,554,669 V664A possibly damaging Het
Tmem241 A T 18: 12,106,009 probably benign Het
Tmprss15 T C 16: 79,003,389 D602G probably damaging Het
Trbv15 T C 6: 41,141,265 probably benign Het
Wdr70 A T 15: 8,019,587 probably null Het
Other mutations in Ephb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Ephb6 APN 6 41615911 unclassified probably benign
IGL01691:Ephb6 APN 6 41614515 missense probably benign 0.26
IGL02052:Ephb6 APN 6 41613322 missense probably benign
IGL02079:Ephb6 APN 6 41616014 missense possibly damaging 0.57
IGL03089:Ephb6 APN 6 41614174 missense probably damaging 1.00
P4748:Ephb6 UTSW 6 41617285 missense probably damaging 0.96
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0974:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1610:Ephb6 UTSW 6 41614373 nonsense probably null
R1658:Ephb6 UTSW 6 41614245 missense probably damaging 1.00
R1687:Ephb6 UTSW 6 41617366 missense probably benign 0.08
R1733:Ephb6 UTSW 6 41619720 missense probably benign 0.10
R2191:Ephb6 UTSW 6 41616085 missense possibly damaging 0.82
R2439:Ephb6 UTSW 6 41618735 missense probably benign 0.31
R2915:Ephb6 UTSW 6 41614238 missense probably damaging 1.00
R3020:Ephb6 UTSW 6 41614521 missense probably damaging 1.00
R3499:Ephb6 UTSW 6 41616159 nonsense probably null
R4606:Ephb6 UTSW 6 41616574 missense probably benign 0.15
R4663:Ephb6 UTSW 6 41617865 missense probably damaging 1.00
R4668:Ephb6 UTSW 6 41614602 missense possibly damaging 0.91
R4762:Ephb6 UTSW 6 41618160 missense probably damaging 0.99
R4767:Ephb6 UTSW 6 41614185 missense possibly damaging 0.81
R4780:Ephb6 UTSW 6 41616139 missense probably damaging 1.00
R4846:Ephb6 UTSW 6 41616809 missense probably benign
R4851:Ephb6 UTSW 6 41618145 missense probably benign 0.00
R5016:Ephb6 UTSW 6 41618107 missense probably benign 0.01
R5122:Ephb6 UTSW 6 41613404 missense probably benign 0.00
R5313:Ephb6 UTSW 6 41616793 missense possibly damaging 0.68
R5615:Ephb6 UTSW 6 41619291 missense probably benign
R5623:Ephb6 UTSW 6 41616481 missense probably benign 0.20
R5686:Ephb6 UTSW 6 41619704 missense possibly damaging 0.57
R5840:Ephb6 UTSW 6 41615573 missense possibly damaging 0.94
R6147:Ephb6 UTSW 6 41616781 missense probably damaging 1.00
R6645:Ephb6 UTSW 6 41617272 missense probably benign 0.01
R6730:Ephb6 UTSW 6 41617374 nonsense probably null
X0027:Ephb6 UTSW 6 41620080 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCTATGGAGAACGGCCCTAC -3'
(R):5'- TGCGAATCATCTTGTCAAATGCAGC -3'

Sequencing Primer
(F):5'- CTGACATAGACCTTTGCTGATG -3'
(R):5'- TCTTGTCAAATGCAGCTACCAG -3'
Posted On2013-07-30