Incidental Mutation 'R0106:Olfr974'
ID63341
Institutional Source Beutler Lab
Gene Symbol Olfr974
Ensembl Gene ENSMUSG00000051493
Gene Nameolfactory receptor 974
SynonymsGA_x6K02T2PVTD-33640290-33641222, MOR171-1
MMRRC Submission 038392-MU
Accession Numbers

Genbank: NM_147107

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0106 (G1)
Quality Score153
Status Validated
Chromosome9
Chromosomal Location39937501-39945170 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GC to G at 39942823 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062833] [ENSMUST00000213246]
Predicted Effect probably null
Transcript: ENSMUST00000062833
SMART Domains Protein: ENSMUSP00000062985
Gene: ENSMUSG00000051493

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.6e-52 PFAM
Pfam:7tm_1 41 290 1.3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213246
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,415,194 noncoding transcript Het
Abcb9 T C 5: 124,083,060 N276S possibly damaging Het
Arhgef25 A G 10: 127,184,010 probably null Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Aspm C A 1: 139,476,876 Q1315K probably benign Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
BC055324 T C 1: 163,982,811 probably benign Het
Brf1 A G 12: 112,973,463 probably benign Het
Card19 A C 13: 49,208,145 D3E probably benign Het
Chd6 A G 2: 160,967,902 F1480L probably damaging Het
Ckap5 T C 2: 91,578,205 I915T possibly damaging Het
Ckap5 T A 2: 91,615,840 I1836N probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Cramp1l A G 17: 24,972,376 V1037A probably benign Het
Cspg5 C A 9: 110,246,532 P112Q probably damaging Het
Cyp2g1 T A 7: 26,814,182 I182N probably damaging Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Ephb6 T C 6: 41,619,594 probably benign Het
Fkbp6 C T 5: 135,340,004 R234Q probably benign Het
Gda T C 19: 21,397,556 D332G probably benign Het
Ggt7 C T 2: 155,494,893 A560T possibly damaging Het
Glis3 A T 19: 28,531,868 S239T possibly damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hsdl1 T A 8: 119,565,778 S254C probably damaging Het
Igsf6 T A 7: 121,074,454 I18F probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kif13a G T 13: 46,825,347 probably benign Het
Kif14 T C 1: 136,479,924 probably benign Het
L2hgdh A T 12: 69,705,789 Y239* probably null Het
Lama3 T C 18: 12,403,982 V228A probably damaging Het
Lamp1 A G 8: 13,174,550 T405A probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk12 T C 15: 89,132,984 probably benign Het
Mdga2 A T 12: 66,716,706 N205K probably damaging Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nat10 A G 2: 103,757,205 V55A probably damaging Het
Nlrp10 T C 7: 108,925,322 E317G possibly damaging Het
Nomo1 T C 7: 46,037,632 I72T probably damaging Het
Olfr1450 A G 19: 12,954,356 I256V probably benign Het
Pappa2 C T 1: 158,714,977 C1780Y probably damaging Het
Pgm2l1 A G 7: 100,250,373 M65V probably benign Het
Plec C T 15: 76,176,318 E3162K probably damaging Het
Pnisr T C 4: 21,874,617 probably benign Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Prss34 A T 17: 25,298,726 D25V probably damaging Het
Ptpn1 T C 2: 167,976,418 probably benign Het
Pygb A G 2: 150,806,203 D119G probably benign Het
Racgap1 T C 15: 99,642,958 T4A possibly damaging Het
Rap1gap2 A G 11: 74,435,744 C166R probably benign Het
Rbm28 C A 6: 29,127,803 V705L probably benign Het
Rgs1 C T 1: 144,248,549 V50M probably benign Het
Rgs12 C T 5: 34,966,664 T597I probably benign Het
Ros1 T C 10: 52,142,267 N765S possibly damaging Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scube2 A G 7: 109,846,908 probably benign Het
Serpinb10 T A 1: 107,546,744 L212Q probably damaging Het
Slc6a7 A G 18: 61,002,223 V411A probably benign Het
Slco1a6 A T 6: 142,157,390 probably benign Het
Smc1b A T 15: 85,070,819 D1077E probably damaging Het
Srek1 G A 13: 103,743,623 H476Y unknown Het
Strn3 A G 12: 51,621,788 V673A probably benign Het
Tepsin T C 11: 120,091,811 probably null Het
Timmdc1 A C 16: 38,522,362 L58R probably damaging Het
Tmem132c T C 5: 127,554,669 V664A possibly damaging Het
Tmem241 A T 18: 12,106,009 probably benign Het
Tmprss15 T C 16: 79,003,389 D602G probably damaging Het
Trbv15 T C 6: 41,141,265 probably benign Het
Wdr70 A T 15: 8,019,587 probably null Het
Other mutations in Olfr974
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr974 APN 9 39942680 missense probably benign 0.08
IGL01638:Olfr974 APN 9 39942520 missense probably benign 0.03
IGL02826:Olfr974 APN 9 39942958 missense probably damaging 1.00
IGL03136:Olfr974 APN 9 39943036 missense probably damaging 1.00
H2330:Olfr974 UTSW 9 39942920 missense probably damaging 1.00
R0005:Olfr974 UTSW 9 39942956 missense probably benign
R1769:Olfr974 UTSW 9 39942955 missense probably benign 0.43
R1870:Olfr974 UTSW 9 39942821 missense probably damaging 0.99
R4416:Olfr974 UTSW 9 39942428 missense probably damaging 1.00
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R5105:Olfr974 UTSW 9 39942398 missense probably benign 0.19
R5273:Olfr974 UTSW 9 39942557 missense probably benign
R6520:Olfr974 UTSW 9 39942362 missense possibly damaging 0.90
R7203:Olfr974 UTSW 9 39942509 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCACTATGTCTCACAGGGTCTGC -3'
(R):5'- CAGAAGCCACTTTCTCCTGGGTTG -3'

Sequencing Primer
(F):5'- CATGCTACTGTCCACTGCTG -3'
(R):5'- GATGGAGCCATAGAAGACTCCAAC -3'
Posted On2013-07-30