Incidental Mutation 'R0106:L2hgdh'
ID63350
Institutional Source Beutler Lab
Gene Symbol L2hgdh
Ensembl Gene ENSMUSG00000020988
Gene NameL-2-hydroxyglutarate dehydrogenase
Synonyms
MMRRC Submission 038392-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R0106 (G1)
Quality Score166
Status Validated
Chromosome12
Chromosomal Location69690433-69724873 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 69705789 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 239 (Y239*)
Ref Sequence ENSEMBL: ENSMUSP00000021370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021370]
Predicted Effect probably null
Transcript: ENSMUST00000021370
AA Change: Y239*
SMART Domains Protein: ENSMUSP00000021370
Gene: ENSMUSG00000020988
AA Change: Y239*

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:DAO 51 457 1.9e-72 PFAM
Meta Mutation Damage Score 0.626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes L-2-hydroxyglutarate dehydrogenase, a FAD-dependent enzyme that oxidizes L-2-hydroxyglutarate to alpha-ketoglutarate in a variety of mammalian tissues. Mutations in this gene cause L-2-hydroxyglutaric aciduria, a rare autosomal recessive neurometabolic disorder resulting in moderate to severe mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit increased levels of lysine and arginine associated with decreases in saccharopine, glutamine, and glutamate in adult brains, neurobehavioral deficits, and brain spongiosis with vacuolar lesions mostly affecting oligodendrocytes and myelin sheaths. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,415,194 noncoding transcript Het
Abcb9 T C 5: 124,083,060 N276S possibly damaging Het
Arhgef25 A G 10: 127,184,010 probably null Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Aspm C A 1: 139,476,876 Q1315K probably benign Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
BC055324 T C 1: 163,982,811 probably benign Het
Brf1 A G 12: 112,973,463 probably benign Het
Card19 A C 13: 49,208,145 D3E probably benign Het
Chd6 A G 2: 160,967,902 F1480L probably damaging Het
Ckap5 T C 2: 91,578,205 I915T possibly damaging Het
Ckap5 T A 2: 91,615,840 I1836N probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Cramp1l A G 17: 24,972,376 V1037A probably benign Het
Cspg5 C A 9: 110,246,532 P112Q probably damaging Het
Cyp2g1 T A 7: 26,814,182 I182N probably damaging Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Ephb6 T C 6: 41,619,594 probably benign Het
Fkbp6 C T 5: 135,340,004 R234Q probably benign Het
Gda T C 19: 21,397,556 D332G probably benign Het
Ggt7 C T 2: 155,494,893 A560T possibly damaging Het
Glis3 A T 19: 28,531,868 S239T possibly damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hsdl1 T A 8: 119,565,778 S254C probably damaging Het
Igsf6 T A 7: 121,074,454 I18F probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kif13a G T 13: 46,825,347 probably benign Het
Kif14 T C 1: 136,479,924 probably benign Het
Lama3 T C 18: 12,403,982 V228A probably damaging Het
Lamp1 A G 8: 13,174,550 T405A probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk12 T C 15: 89,132,984 probably benign Het
Mdga2 A T 12: 66,716,706 N205K probably damaging Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nat10 A G 2: 103,757,205 V55A probably damaging Het
Nlrp10 T C 7: 108,925,322 E317G possibly damaging Het
Nomo1 T C 7: 46,037,632 I72T probably damaging Het
Olfr1450 A G 19: 12,954,356 I256V probably benign Het
Olfr974 GC G 9: 39,942,823 probably null Het
Pappa2 C T 1: 158,714,977 C1780Y probably damaging Het
Pgm2l1 A G 7: 100,250,373 M65V probably benign Het
Plec C T 15: 76,176,318 E3162K probably damaging Het
Pnisr T C 4: 21,874,617 probably benign Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Prss34 A T 17: 25,298,726 D25V probably damaging Het
Ptpn1 T C 2: 167,976,418 probably benign Het
Pygb A G 2: 150,806,203 D119G probably benign Het
Racgap1 T C 15: 99,642,958 T4A possibly damaging Het
Rap1gap2 A G 11: 74,435,744 C166R probably benign Het
Rbm28 C A 6: 29,127,803 V705L probably benign Het
Rgs1 C T 1: 144,248,549 V50M probably benign Het
Rgs12 C T 5: 34,966,664 T597I probably benign Het
Ros1 T C 10: 52,142,267 N765S possibly damaging Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scube2 A G 7: 109,846,908 probably benign Het
Serpinb10 T A 1: 107,546,744 L212Q probably damaging Het
Slc6a7 A G 18: 61,002,223 V411A probably benign Het
Slco1a6 A T 6: 142,157,390 probably benign Het
Smc1b A T 15: 85,070,819 D1077E probably damaging Het
Srek1 G A 13: 103,743,623 H476Y unknown Het
Strn3 A G 12: 51,621,788 V673A probably benign Het
Tepsin T C 11: 120,091,811 probably null Het
Timmdc1 A C 16: 38,522,362 L58R probably damaging Het
Tmem132c T C 5: 127,554,669 V664A possibly damaging Het
Tmem241 A T 18: 12,106,009 probably benign Het
Tmprss15 T C 16: 79,003,389 D602G probably damaging Het
Trbv15 T C 6: 41,141,265 probably benign Het
Wdr70 A T 15: 8,019,587 probably null Het
Other mutations in L2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:L2hgdh APN 12 69701434 missense possibly damaging 0.67
IGL01505:L2hgdh APN 12 69721401 missense probably damaging 1.00
IGL01871:L2hgdh APN 12 69722095 missense probably damaging 1.00
IGL02169:L2hgdh APN 12 69721397 missense probably damaging 1.00
IGL02253:L2hgdh APN 12 69705760 splice site probably benign
IGL02670:L2hgdh APN 12 69692480 missense possibly damaging 0.86
IGL03069:L2hgdh APN 12 69692399 missense probably benign
R0054:L2hgdh UTSW 12 69721331 missense possibly damaging 0.82
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0579:L2hgdh UTSW 12 69701272 splice site probably benign
R1421:L2hgdh UTSW 12 69701318 missense probably benign
R1797:L2hgdh UTSW 12 69699566 missense probably benign
R3082:L2hgdh UTSW 12 69722084 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAATGTGGTGGCTGGTTCCAAGG -3'
(R):5'- TGCCGAGTGTTTAACACCCCATGC -3'

Sequencing Primer
(F):5'- gaactataattgaggttgtgctctg -3'
(R):5'- gtgggaggcagaggcag -3'
Posted On2013-07-30