Incidental Mutation 'R0693:Klhl9'
ID 63395
Institutional Source Beutler Lab
Gene Symbol Klhl9
Ensembl Gene ENSMUSG00000070923
Gene Name kelch-like 9
Synonyms C530050O22Rik
MMRRC Submission 038878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0693 (G1)
Quality Score 100
Status Not validated
Chromosome 4
Chromosomal Location 88636529-88640702 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 88638527 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 571 (K571N)
Ref Sequence ENSEMBL: ENSMUSP00000092602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]
AlphaFold Q6ZPT1
Predicted Effect probably benign
Transcript: ENSMUST00000094993
AA Change: K571N

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923
AA Change: K571N

DomainStartEndE-ValueType
BTB 50 149 7.21e-22 SMART
BACK 154 255 3.93e-27 SMART
low complexity region 276 287 N/A INTRINSIC
Kelch 299 347 1.13e-2 SMART
Kelch 348 399 1.92e-5 SMART
Kelch 400 446 1.59e-11 SMART
Kelch 447 493 2.61e-7 SMART
Kelch 494 545 1.58e-6 SMART
Kelch 546 594 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181601
SMART Domains Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
Meta Mutation Damage Score 0.0771 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 A T 9: 42,929,697 (GRCm39) N199K probably damaging Het
Ccnj T A 19: 40,825,551 (GRCm39) L87H probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gbgt1 G A 2: 28,394,842 (GRCm39) G160D probably damaging Het
Gm5114 T C 7: 39,058,188 (GRCm39) D477G probably benign Het
Gp1ba T C 11: 70,531,284 (GRCm39) probably benign Het
Inpp4b A T 8: 82,723,943 (GRCm39) T492S probably benign Het
Islr2 T C 9: 58,107,027 (GRCm39) T78A possibly damaging Het
Msl3l2 G A 10: 55,991,947 (GRCm39) R224Q possibly damaging Het
Nfe2l3 A G 6: 51,410,034 (GRCm39) T50A possibly damaging Het
Or7g32 G A 9: 19,389,268 (GRCm39) Q90* probably null Het
Or8b40 A G 9: 38,027,325 (GRCm39) T78A probably benign Het
Prkg1 T A 19: 30,572,378 (GRCm39) Q426L probably benign Het
Rnf215 G A 11: 4,090,401 (GRCm39) probably null Het
Sp100 T A 1: 85,594,726 (GRCm39) probably null Het
Tbc1d21 G A 9: 58,268,570 (GRCm39) T263M probably damaging Het
Tenm2 G A 11: 35,915,636 (GRCm39) T1966M probably damaging Het
Tnni3k T C 3: 154,667,609 (GRCm39) Y268C probably damaging Het
Usp34 A G 11: 23,402,637 (GRCm39) T2477A probably damaging Het
Other mutations in Klhl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Klhl9 APN 4 88,639,056 (GRCm39) missense probably damaging 1.00
IGL00592:Klhl9 APN 4 88,639,378 (GRCm39) missense probably damaging 0.99
IGL01986:Klhl9 APN 4 88,640,016 (GRCm39) missense probably damaging 0.99
IGL02364:Klhl9 APN 4 88,639,407 (GRCm39) missense probably damaging 1.00
IGL02994:Klhl9 APN 4 88,639,434 (GRCm39) nonsense probably null
minnow UTSW 4 88,639,843 (GRCm39) nonsense probably null
R0319:Klhl9 UTSW 4 88,638,691 (GRCm39) missense possibly damaging 0.91
R0360:Klhl9 UTSW 4 88,638,527 (GRCm39) missense probably benign 0.05
R0364:Klhl9 UTSW 4 88,638,527 (GRCm39) missense probably benign 0.05
R0961:Klhl9 UTSW 4 88,639,974 (GRCm39) missense probably benign 0.16
R1521:Klhl9 UTSW 4 88,640,230 (GRCm39) missense probably benign 0.03
R2891:Klhl9 UTSW 4 88,639,207 (GRCm39) missense probably benign 0.02
R3762:Klhl9 UTSW 4 88,639,830 (GRCm39) missense possibly damaging 0.93
R4584:Klhl9 UTSW 4 88,640,144 (GRCm39) missense probably damaging 1.00
R4678:Klhl9 UTSW 4 88,639,161 (GRCm39) missense probably damaging 1.00
R4888:Klhl9 UTSW 4 88,640,182 (GRCm39) missense probably benign 0.01
R5030:Klhl9 UTSW 4 88,638,771 (GRCm39) missense possibly damaging 0.96
R5082:Klhl9 UTSW 4 88,639,622 (GRCm39) missense probably damaging 0.97
R6466:Klhl9 UTSW 4 88,639,399 (GRCm39) missense probably benign 0.00
R7032:Klhl9 UTSW 4 88,639,843 (GRCm39) nonsense probably null
R7532:Klhl9 UTSW 4 88,639,090 (GRCm39) missense possibly damaging 0.79
R7602:Klhl9 UTSW 4 88,640,646 (GRCm39) start gained probably benign
R7618:Klhl9 UTSW 4 88,638,772 (GRCm39) missense possibly damaging 0.80
R7879:Klhl9 UTSW 4 88,638,575 (GRCm39) missense probably damaging 1.00
R7909:Klhl9 UTSW 4 88,639,238 (GRCm39) missense probably benign 0.12
R8372:Klhl9 UTSW 4 88,639,596 (GRCm39) missense probably damaging 1.00
R8990:Klhl9 UTSW 4 88,640,205 (GRCm39) missense probably benign 0.00
R9024:Klhl9 UTSW 4 88,639,999 (GRCm39) missense probably damaging 1.00
R9619:Klhl9 UTSW 4 88,639,062 (GRCm39) missense probably benign 0.04
X0063:Klhl9 UTSW 4 88,640,188 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGGTAGCTGTACCTTGGCAATC -3'
(R):5'- ACTATTCGCCAACTCTTGACCAGTG -3'

Sequencing Primer
(F):5'- AGGGGACCTCCATTTAATGTTTCAG -3'
(R):5'- GGACACCAATTGCTGCTATG -3'
Posted On 2013-07-30