Incidental Mutation 'R0694:Trim50'
ID63425
Institutional Source Beutler Lab
Gene Symbol Trim50
Ensembl Gene ENSMUSG00000053388
Gene Nametripartite motif-containing 50
Synonyms
MMRRC Submission 038879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0694 (G1)
Quality Score94
Status Not validated
Chromosome5
Chromosomal Location135353295-135368005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135353545 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 84 (I84L)
Ref Sequence ENSEMBL: ENSMUSP00000106811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044972] [ENSMUST00000065785] [ENSMUST00000111180] [ENSMUST00000201534] [ENSMUST00000201784] [ENSMUST00000201791]
Predicted Effect probably benign
Transcript: ENSMUST00000044972
SMART Domains Protein: ENSMUSP00000043193
Gene: ENSMUSG00000040013

DomainStartEndE-ValueType
Pfam:FKBP_C 48 140 3.5e-20 PFAM
Blast:TPR 171 195 1e-7 BLAST
low complexity region 196 206 N/A INTRINSIC
Pfam:TPR_2 220 252 3.3e-4 PFAM
Pfam:TPR_2 253 284 5.4e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065785
AA Change: I84L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066662
Gene: ENSMUSG00000053388
AA Change: I84L

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 292 344 1.07e-13 SMART
SPRY 345 473 7.48e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111180
AA Change: I84L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106811
Gene: ENSMUSG00000053388
AA Change: I84L

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 293 345 1.07e-13 SMART
SPRY 346 474 7.48e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201534
SMART Domains Protein: ENSMUSP00000144471
Gene: ENSMUSG00000040013

DomainStartEndE-ValueType
Pfam:FKBP_C 48 140 3.5e-20 PFAM
Blast:TPR 171 195 1e-7 BLAST
low complexity region 196 206 N/A INTRINSIC
Pfam:TPR_2 220 252 3.3e-4 PFAM
Pfam:TPR_2 253 284 5.4e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201784
SMART Domains Protein: ENSMUSP00000144381
Gene: ENSMUSG00000040013

DomainStartEndE-ValueType
Pfam:FKBP_C 48 140 7.6e-20 PFAM
Blast:TPR 171 195 1e-7 BLAST
low complexity region 196 206 N/A INTRINSIC
Pfam:TPR_2 220 252 1.3e-4 PFAM
Pfam:TPR_2 253 284 2.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201791
SMART Domains Protein: ENSMUSP00000144460
Gene: ENSMUSG00000040013

DomainStartEndE-ValueType
Pfam:FKBP_C 48 140 5.9e-20 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:TPR_2 180 212 1.1e-4 PFAM
Pfam:TPR_2 213 244 1.8e-4 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired secretion of gastric acid with impaired stimulated tubulovesicular dynamics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b C T 13: 14,187,834 T961I probably damaging Het
Asb13 G T 13: 3,649,480 A227S probably benign Het
Atp6v1g1 C T 4: 63,549,993 R78W probably benign Het
Bglap2 C T 3: 88,378,416 D31N possibly damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Fbxo22 T A 9: 55,221,139 I248N probably damaging Het
Fbxo39 G A 11: 72,318,469 R385Q probably benign Het
Glyr1 T C 16: 5,026,560 N284S probably damaging Het
Hus1 C T 11: 9,007,531 W144* probably null Het
Kcna1 T C 6: 126,642,245 T371A probably damaging Het
Prkdc A T 16: 15,768,637 N2510I probably damaging Het
Ptprn2 G T 12: 116,824,355 A105S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sema6d T C 2: 124,664,041 S633P probably damaging Het
Sulf2 T C 2: 166,085,791 N362S probably damaging Het
Tmem136 C T 9: 43,111,626 W126* probably null Het
Trpc3 A T 3: 36,671,555 F91I possibly damaging Het
Zfp804a A G 2: 82,053,804 Y5C probably damaging Het
Other mutations in Trim50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Trim50 APN 5 135363954 missense probably damaging 0.99
IGL01565:Trim50 APN 5 135367501 missense probably benign 0.05
IGL01768:Trim50 APN 5 135363882 missense possibly damaging 0.77
IGL03394:Trim50 APN 5 135363953 missense probably damaging 0.97
PIT4498001:Trim50 UTSW 5 135353477 missense probably damaging 1.00
R0137:Trim50 UTSW 5 135366633 missense probably damaging 1.00
R1797:Trim50 UTSW 5 135353501 missense possibly damaging 0.96
R1806:Trim50 UTSW 5 135358889 missense probably benign 0.00
R4688:Trim50 UTSW 5 135367140 missense probably damaging 1.00
R5034:Trim50 UTSW 5 135367293 missense possibly damaging 0.59
R5334:Trim50 UTSW 5 135367476 missense probably damaging 1.00
R5336:Trim50 UTSW 5 135367476 missense probably damaging 1.00
R5337:Trim50 UTSW 5 135367476 missense probably damaging 1.00
R5689:Trim50 UTSW 5 135353662 missense probably damaging 0.98
R6119:Trim50 UTSW 5 135353420 missense probably benign
R6377:Trim50 UTSW 5 135353600 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTACTGCAAGGACTGCCTGGATAAC -3'
(R):5'- AAAAGTCTGGCAAGGGACTCGC -3'

Sequencing Primer
(F):5'- TGGATAACTTGTCCCAACACCTG -3'
(R):5'- cactgacttccacaaaatgtcc -3'
Posted On2013-07-30