Incidental Mutation 'R0720:Smcr8'
ID63524
Institutional Source Beutler Lab
Gene Symbol Smcr8
Ensembl Gene ENSMUSG00000049323
Gene NameSmith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonyms2310076G09Rik, D030073L15Rik
MMRRC Submission 038902-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0720 (G1)
Quality Score84
Status Validated
Chromosome11
Chromosomal Location60777524-60788287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60778443 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 139 (L139P)
Ref Sequence ENSEMBL: ENSMUSP00000099728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000056907] [ENSMUST00000102667] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
Predicted Effect probably benign
Transcript: ENSMUST00000002891
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056907
AA Change: L139P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: L139P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102667
AA Change: L139P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: L139P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102668
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117743
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120417
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130068
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A G 17: 42,713,172 I136T probably damaging Het
Bbs7 T C 3: 36,592,423 D416G probably damaging Het
Commd4 G T 9: 57,155,434 D179E probably benign Het
Cyp3a57 T C 5: 145,390,403 probably benign Het
Dnah5 A G 15: 28,313,861 N1941S probably null Het
Dynap T C 18: 70,240,984 D157G unknown Het
Eri3 T C 4: 117,553,045 probably null Het
Fam189a1 A G 7: 64,819,910 probably benign Het
Fbxo25 A G 8: 13,935,222 Y305C probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fxr2 A G 11: 69,639,415 D36G probably benign Het
Gas2l3 T C 10: 89,413,943 T438A probably benign Het
Gcm1 A T 9: 78,064,641 Y288F possibly damaging Het
Gm3164 C A 14: 4,442,719 S218R probably benign Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Htra3 T C 5: 35,654,109 I392M probably damaging Het
Kansl1l T C 1: 66,801,356 M262V possibly damaging Het
Lrrc47 T C 4: 154,019,887 probably null Het
Macf1 A T 4: 123,432,925 N4926K probably damaging Het
Mllt10 T C 2: 18,196,595 S631P probably benign Het
Nlrp14 A G 7: 107,182,013 H139R probably benign Het
Olfr1153 A T 2: 87,896,669 T157S probably benign Het
Olfr394 T A 11: 73,887,862 N170I probably benign Het
Ptger2 T C 14: 44,989,133 C57R probably benign Het
Rhot1 T C 11: 80,223,943 V59A probably damaging Het
Rmdn2 G A 17: 79,668,029 probably null Het
Rxfp2 G T 5: 150,044,119 K148N probably benign Het
Sec23a G A 12: 58,971,271 T623M probably damaging Het
Spag6l A T 16: 16,767,096 probably benign Het
Taar1 T C 10: 23,921,073 I223T probably damaging Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnfsf18 A G 1: 161,503,587 Y102C possibly damaging Het
Tns1 A G 1: 73,925,581 L1297P probably benign Het
Txndc8 C T 4: 57,984,245 probably benign Het
Ubr5 T C 15: 37,972,991 N2622S probably damaging Het
Vmn2r99 T A 17: 19,379,043 F330I probably benign Het
Zdhhc2 T A 8: 40,472,907 probably null Het
Other mutations in Smcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60778632 unclassified probably null
IGL00514:Smcr8 APN 11 60778367 nonsense probably null
IGL01563:Smcr8 APN 11 60783845 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60778184 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60779722 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60778895 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60778461 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60778027 unclassified probably benign
chauvenist UTSW 11 60778598 missense probably damaging 1.00
patriot UTSW 11 60778032 missense probably damaging 1.00
patriot2 UTSW 11 60778028 start codon destroyed probably null 1.00
patriot3 UTSW 11 60779870 nonsense probably null
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60780222 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60779750 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60779532 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60778032 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60778184 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60778028 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60779504 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60778610 unclassified probably null
R4802:Smcr8 UTSW 11 60778610 unclassified probably null
R4862:Smcr8 UTSW 11 60778071 missense probably benign 0.01
R5108:Smcr8 UTSW 11 60779870 nonsense probably null
R5361:Smcr8 UTSW 11 60778292 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60784151 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60780382 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60779568 missense probably damaging 1.00
R6277:Smcr8 UTSW 11 60778809 missense probably benign 0.07
R6289:Smcr8 UTSW 11 60778598 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60779015 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60778862 missense possibly damaging 0.85
R7062:Smcr8 UTSW 11 60780354 missense probably damaging 1.00
R7176:Smcr8 UTSW 11 60778946 missense probably damaging 1.00
R7516:Smcr8 UTSW 11 60779988 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCATTTCCGAGTTCTCTGAGCAG -3'
(R):5'- TTCAAGTTCCCCAGCGAATGCC -3'

Sequencing Primer
(F):5'- CCAATGACACCAAAGTTTTTGGC -3'
(R):5'- AGCGAATGCCTTCCTGTTG -3'
Posted On2013-07-30