Incidental Mutation 'R0722:Pld5'
ID63545
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Namephospholipase D family, member 5
SynonymsB230365F16Rik
MMRRC Submission 038904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0722 (G1)
Quality Score184
Status Validated
Chromosome1
Chromosomal Location175962306-176275312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175975515 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 395 (F395L)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000104983] [ENSMUST00000111167] [ENSMUST00000125404]
Predicted Effect probably benign
Transcript: ENSMUST00000065967
AA Change: F395L

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: F395L

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104983
SMART Domains Protein: ENSMUSP00000100599
Gene: ENSMUSG00000078184

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
RRM 74 147 8.44e-22 SMART
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111167
AA Change: F333L

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: F333L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T C 11: 80,156,984 F89L possibly damaging Het
Akr1c13 A G 13: 4,197,932 probably null Het
Atp10a A G 7: 58,816,183 I1053V possibly damaging Het
Bmper G T 9: 23,373,928 V258L probably benign Het
Brd4 T C 17: 32,212,982 H636R possibly damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Ccbe1 C T 18: 66,084,806 C112Y probably damaging Het
Ccdc28b T A 4: 129,621,152 probably null Het
Cd320 T C 17: 33,846,030 S46P possibly damaging Het
Cfap44 G A 16: 44,404,676 E95K possibly damaging Het
Clpp T C 17: 56,992,901 V144A probably damaging Het
Crtam A T 9: 40,992,616 C96S probably damaging Het
D3Ertd254e C T 3: 36,165,069 H414Y probably benign Het
Dcst1 C T 3: 89,353,805 R480H probably benign Het
Dock2 A T 11: 34,464,970 probably benign Het
Ermard A G 17: 15,022,128 T189A probably benign Het
Gm10840 A G 11: 106,161,076 probably benign Het
Gm4845 T A 1: 141,256,860 noncoding transcript Het
Heatr1 A G 13: 12,406,037 E403G probably benign Het
Herc4 A G 10: 63,286,065 I399V probably null Het
Htr1f A G 16: 64,925,891 I346T probably damaging Het
Igf2r T C 17: 12,715,495 probably null Het
Jmy G A 13: 93,452,817 T644I probably benign Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Krt13 T G 11: 100,119,153 K297T probably damaging Het
Lrba T C 3: 86,605,989 probably null Het
Lrrc8b T C 5: 105,480,112 V108A possibly damaging Het
Lrrc8c T A 5: 105,579,548 V26E probably damaging Het
Olfr478 A G 7: 108,032,334 F3S probably benign Het
Olfr981 A G 9: 40,022,999 D202G probably damaging Het
Pcna A G 2: 132,251,235 probably benign Het
Pgm1 A T 5: 64,107,679 R348* probably null Het
Pikfyve T G 1: 65,253,523 S1378A probably damaging Het
Pkp2 T C 16: 16,247,028 V472A probably benign Het
Plekhb1 A T 7: 100,645,603 Y169N probably damaging Het
Polr2c T A 8: 94,862,637 Y186N probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prr5l A G 2: 101,717,474 probably benign Het
Ptbp2 C T 3: 119,720,921 R419Q possibly damaging Het
Ralgapa2 A G 2: 146,388,531 V1038A probably damaging Het
Rassf2 A G 2: 132,002,910 V204A probably damaging Het
Slc22a22 T C 15: 57,256,553 probably null Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Smc5 C A 19: 23,208,927 L1055F probably damaging Het
Spidr A G 16: 15,912,781 F620S probably damaging Het
Susd1 A G 4: 59,379,749 S293P possibly damaging Het
Tepsin A G 11: 120,095,337 probably benign Het
Vmn2r68 A T 7: 85,221,586 L830I possibly damaging Het
Vtn A G 11: 78,500,854 probably benign Het
Wdr66 T A 5: 123,256,185 V379E probably damaging Het
Zfp280d T G 9: 72,312,101 S162A possibly damaging Het
Zfp608 T G 18: 54,900,234 K409T probably damaging Het
Zfp738 A T 13: 67,671,524 M116K probably benign Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 176140019 missense probably damaging 1.00
IGL00949:Pld5 APN 1 175975473 missense probably damaging 1.00
IGL01067:Pld5 APN 1 176274879 utr 5 prime probably benign
IGL02174:Pld5 APN 1 176274744 missense possibly damaging 0.86
IGL02380:Pld5 APN 1 176140044 missense probably damaging 0.97
IGL02879:Pld5 APN 1 175970591 missense probably damaging 1.00
R0087:Pld5 UTSW 1 175984459 missense probably damaging 0.98
R0135:Pld5 UTSW 1 175970589 missense probably damaging 1.00
R0144:Pld5 UTSW 1 175970541 missense probably benign 0.00
R0362:Pld5 UTSW 1 175975580 nonsense probably null
R0453:Pld5 UTSW 1 176089956 missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176274729 missense probably benign 0.00
R0751:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R0785:Pld5 UTSW 1 175975452 splice site probably benign
R1184:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1501:Pld5 UTSW 1 175975521 missense probably benign 0.36
R1644:Pld5 UTSW 1 175975626 missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175964013 missense probably benign 0.27
R2426:Pld5 UTSW 1 175963976 missense probably benign
R3508:Pld5 UTSW 1 175994037 missense probably damaging 1.00
R3917:Pld5 UTSW 1 175963938 missense probably benign 0.00
R4207:Pld5 UTSW 1 175993875 missense probably damaging 1.00
R4373:Pld5 UTSW 1 176140017 missense probably damaging 1.00
R4828:Pld5 UTSW 1 176274867 missense probably benign 0.06
R4831:Pld5 UTSW 1 176274884 utr 5 prime probably benign
R5861:Pld5 UTSW 1 176090005 missense probably damaging 1.00
R6182:Pld5 UTSW 1 176044854 missense probably benign 0.35
R6191:Pld5 UTSW 1 175970534 missense probably benign 0.04
R6246:Pld5 UTSW 1 175963909 nonsense probably null
R6737:Pld5 UTSW 1 176090022 missense probably damaging 1.00
R7082:Pld5 UTSW 1 176089876 missense probably benign 0.21
R7164:Pld5 UTSW 1 176213621 start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176274735 missense possibly damaging 0.79
X0004:Pld5 UTSW 1 176261522 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCGTGTTACAAATAAGGTCAGTAGGG -3'
(R):5'- CGGTTGCCACGATGCAGAATG -3'

Sequencing Primer
(F):5'- ggagagaccctgccttaaaac -3'
(R):5'- CCACGATGCAGAATGAAATAATGC -3'
Posted On2013-07-30