Incidental Mutation 'R0718:Sf3b1'
ID63666
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Namesplicing factor 3b, subunit 1
SynonymsTarg4, SAP155, Prp10, 2810001M05Rik, SF3b155
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0718 (G1)
Quality Score174
Status Validated
Chromosome1
Chromosomal Location54985169-55027481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55019385 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 15 (I15T)
Ref Sequence ENSEMBL: ENSMUSP00000139469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]
Predicted Effect probably benign
Transcript: ENSMUST00000027127
AA Change: I15T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: I15T

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189051
Predicted Effect probably damaging
Transcript: ENSMUST00000191303
AA Change: I15T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: I15T

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
Meta Mutation Damage Score 0.502 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rptor A G 11: 119,872,376 M929V probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 54987486 missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 54996931 splice site probably benign
IGL01380:Sf3b1 APN 1 54987949 missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 54987429 missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55007707 missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55012213 missense probably benign
colt UTSW 1 54997156 missense probably benign 0.45
Glock UTSW 1 55001046 missense probably damaging 0.96
handgun UTSW 1 55007507 missense probably damaging 1.00
kalashnikov UTSW 1 55019265 missense probably damaging 0.99
magazine UTSW 1 55012182 nonsense probably null
revolver UTSW 1 55019389 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0190:Sf3b1 UTSW 1 54990306 missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 54998108 missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55019271 missense probably damaging 1.00
R0991:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55003154 missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55001421 missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55019377 missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55000652 missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 54998188 missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55007633 missense probably benign
R2429:Sf3b1 UTSW 1 55016801 missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 54999626 critical splice donor site probably null
R3772:Sf3b1 UTSW 1 54999991 intron probably benign
R3911:Sf3b1 UTSW 1 55019389 nonsense probably null
R3970:Sf3b1 UTSW 1 55012182 nonsense probably null
R4706:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 54999712 missense probably benign
R5053:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55003310 missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55003150 missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 54998175 missense probably benign 0.27
R5636:Sf3b1 UTSW 1 54997193 missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55000298 missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55007507 missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55007518 missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 54999655 missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55019395 missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 54997156 missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55001046 missense probably damaging 0.96
R7001:Sf3b1 UTSW 1 55014481 critical splice donor site probably null
R7302:Sf3b1 UTSW 1 55016790 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCAGTGAGGACCCTAGTATTAAGC -3'
(R):5'- TCCTTTCACCTGATGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAGGTCAGGAGATACATGTGTAGAT -3'
Posted On2013-07-30