Incidental Mutation 'R0718:Rptor'
ID63720
Institutional Source Beutler Lab
Gene Symbol Rptor
Ensembl Gene ENSMUSG00000025583
Gene Nameregulatory associated protein of MTOR, complex 1
Synonymsraptor, Rap, 4932417H02Rik
MMRRC Submission 038900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0718 (G1)
Quality Score106
Status Validated
Chromosome11
Chromosomal Location119602905-119899576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119872376 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 929 (M929V)
Ref Sequence ENSEMBL: ENSMUSP00000026671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000131217] [ENSMUST00000147781]
Predicted Effect probably benign
Transcript: ENSMUST00000026671
AA Change: M929V

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: M929V

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Pfam:HEAT_2 559 668 7.9e-11 PFAM
Pfam:HEAT 602 630 1.9e-6 PFAM
low complexity region 755 772 N/A INTRINSIC
low complexity region 877 887 N/A INTRINSIC
low complexity region 939 945 N/A INTRINSIC
WD40 1012 1050 2.56e1 SMART
WD40 1052 1097 4.28e0 SMART
WD40 1105 1151 1.83e2 SMART
WD40 1154 1194 1.82e-2 SMART
WD40 1200 1240 5.35e-1 SMART
WD40 1246 1281 7.13e0 SMART
WD40 1283 1329 2.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126802
Predicted Effect probably benign
Transcript: ENSMUST00000131217
SMART Domains Protein: ENSMUSP00000125667
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136662
AA Change: M223V
SMART Domains Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583
AA Change: M223V

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147781
SMART Domains Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

DomainStartEndE-ValueType
Raptor_N 54 207 2.3e-98 SMART
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 A T 3: 95,679,608 Y811N possibly damaging Het
Adrm1 T C 2: 180,175,147 probably benign Het
Alms1 T A 6: 85,621,821 S1210T probably benign Het
Ampd3 C T 7: 110,777,808 P11L probably damaging Het
Arhgap5 A G 12: 52,516,507 E87G possibly damaging Het
Armc5 C T 7: 128,240,070 probably benign Het
Asic2 C G 11: 80,971,456 probably benign Het
Asph A G 4: 9,514,683 probably benign Het
Bicd2 T A 13: 49,377,875 probably null Het
Brip1 A G 11: 86,143,305 L530P possibly damaging Het
Bsn G T 9: 108,111,360 probably benign Het
Btnl4 T A 17: 34,469,634 H390L probably benign Het
Ccdc70 A C 8: 21,973,308 K38T probably damaging Het
Ccni G A 5: 93,202,316 P35S probably benign Het
Cdh17 A G 4: 11,810,451 D714G possibly damaging Het
Cenpf A G 1: 189,653,984 L2033P probably damaging Het
Cfap69 A T 5: 5,621,924 M328K probably damaging Het
Cmah T G 13: 24,417,210 probably null Het
Cog6 T C 3: 53,010,629 T163A probably benign Het
Cyp2j8 G A 4: 96,501,196 S130F probably benign Het
Dgki A G 6: 37,012,896 V636A probably damaging Het
Dmkn T A 7: 30,764,786 probably benign Het
Dnah6 A G 6: 73,035,293 I3679T possibly damaging Het
Dsp A T 13: 38,196,764 Y2495F possibly damaging Het
Exosc4 C T 15: 76,329,489 A171V probably benign Het
Fbxw24 A G 9: 109,623,509 probably benign Het
Flvcr1 A T 1: 191,025,582 L171Q probably damaging Het
Fsd1 G T 17: 55,996,445 probably null Het
Gm7732 A G 17: 21,129,844 noncoding transcript Het
H2-K2 A C 17: 33,975,623 noncoding transcript Het
Hgf A G 5: 16,593,859 N295S probably damaging Het
Ift88 T A 14: 57,517,413 D811E probably benign Het
Igsf9b T A 9: 27,323,361 probably null Het
Immt T A 6: 71,863,172 V311E probably damaging Het
Ipo11 T A 13: 106,919,611 N51I possibly damaging Het
Isy1 T C 6: 87,819,176 K260E probably damaging Het
Jchain T G 5: 88,526,202 I28L probably benign Het
Jmjd1c T A 10: 67,218,946 probably null Het
Kif13b T C 14: 64,751,662 probably benign Het
Klhdc7b T C 15: 89,388,169 Y427H possibly damaging Het
Klhl8 T C 5: 103,876,293 probably benign Het
Lrp2 C T 2: 69,510,948 D963N probably damaging Het
Ltbp3 G T 19: 5,746,748 probably benign Het
Ltf C A 9: 111,040,379 Q41K probably benign Het
Med4 T A 14: 73,516,657 I148N probably damaging Het
Mlh3 T G 12: 85,247,697 S1242R possibly damaging Het
Mllt6 T C 11: 97,676,359 probably benign Het
Mpdz A G 4: 81,292,473 I1712T possibly damaging Het
Mrgprb4 T A 7: 48,198,553 H209L probably benign Het
Nkapl A T 13: 21,468,440 M1K probably null Het
Nmur2 T A 11: 56,029,498 probably benign Het
Nsun2 T A 13: 69,543,697 probably benign Het
Olfr1082 G A 2: 86,594,081 T249I probably benign Het
Olfr1130 A G 2: 87,607,927 I180V probably benign Het
Ovgp1 T C 3: 105,974,830 probably benign Het
Pcdh8 A G 14: 79,770,691 V144A possibly damaging Het
Pcnx3 G A 19: 5,677,728 probably benign Het
Pla2r1 C A 2: 60,479,530 V570L possibly damaging Het
Plxnd1 C A 6: 115,966,638 E1202D possibly damaging Het
Ppp1r37 T C 7: 19,532,254 E529G probably benign Het
Prdm15 A G 16: 97,812,633 F496L possibly damaging Het
Prlhr A T 19: 60,468,005 V41D probably benign Het
Prlhr G T 19: 60,468,059 S23* probably null Het
Prpf4 C T 4: 62,414,540 probably benign Het
Psg26 C T 7: 18,475,235 R416H probably benign Het
Psg26 T C 7: 18,478,287 H381R probably benign Het
Ralgds T G 2: 28,549,116 M717R probably benign Het
Rbms1 T C 2: 60,842,412 N44D probably damaging Het
Rpa1 T C 11: 75,318,401 probably benign Het
Rprd2 T C 3: 95,766,387 N568S probably benign Het
Rspo1 T A 4: 125,007,149 C97S possibly damaging Het
Scin C T 12: 40,079,607 G396S probably damaging Het
Scn9a T C 2: 66,547,112 N409D probably damaging Het
Sf3b1 A G 1: 55,019,385 I15T probably damaging Het
Sh3bp2 T C 5: 34,555,495 V149A probably damaging Het
Slc39a12 T A 2: 14,407,426 probably benign Het
Sp9 G T 2: 73,273,827 A242S possibly damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tatdn3 G T 1: 191,052,849 probably benign Het
Tex14 G A 11: 87,499,613 V379I probably benign Het
Tmed6 T C 8: 107,061,724 N197S probably damaging Het
Ttbk2 G A 2: 120,748,575 L689F probably benign Het
Ttbk2 A T 2: 120,745,160 I1043N probably benign Het
Ttn A G 2: 76,810,696 S5283P probably damaging Het
Ube3b C A 5: 114,402,555 S441* probably null Het
Ush2a G A 1: 188,797,830 C3272Y probably damaging Het
Vac14 T A 8: 110,632,477 I95K probably damaging Het
Vangl2 G A 1: 172,006,217 A433V probably damaging Het
Vwa5b1 A T 4: 138,608,824 V153D probably damaging Het
Zfhx3 T A 8: 108,955,650 D3240E unknown Het
Zfp945 A G 17: 22,851,030 C632R probably damaging Het
Zfyve26 G A 12: 79,265,802 probably benign Het
Zyg11b A T 4: 108,242,076 I606N possibly damaging Het
Other mutations in Rptor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Rptor APN 11 119799445 missense possibly damaging 0.92
IGL01319:Rptor APN 11 119891170 missense probably benign 0.01
IGL01375:Rptor APN 11 119896436 missense possibly damaging 0.68
IGL01899:Rptor APN 11 119857453 missense probably benign 0.04
IGL01927:Rptor APN 11 119657674 missense probably damaging 1.00
IGL02312:Rptor APN 11 119846915 missense possibly damaging 0.84
IGL02620:Rptor APN 11 119780587 missense probably benign 0.12
IGL02651:Rptor APN 11 119892612 missense possibly damaging 0.69
IGL03182:Rptor APN 11 119725145 missense probably damaging 1.00
Velocipede UTSW 11 119895977 missense possibly damaging 0.92
R0103:Rptor UTSW 11 119884967 missense probably benign 0.01
R0179:Rptor UTSW 11 119872367 missense probably benign 0.14
R0217:Rptor UTSW 11 119894912 splice site probably benign
R0219:Rptor UTSW 11 119821777 intron probably benign
R0324:Rptor UTSW 11 119892641 missense probably damaging 1.00
R0432:Rptor UTSW 11 119780553 nonsense probably null
R0730:Rptor UTSW 11 119884954 missense probably benign 0.06
R1019:Rptor UTSW 11 119843743 missense probably damaging 1.00
R1073:Rptor UTSW 11 119743891 missense possibly damaging 0.93
R1424:Rptor UTSW 11 119780593 nonsense probably null
R1579:Rptor UTSW 11 119896001 missense probably benign 0.00
R1766:Rptor UTSW 11 119725061 missense probably damaging 0.99
R1844:Rptor UTSW 11 119756320 missense probably damaging 1.00
R2180:Rptor UTSW 11 119725144 missense probably damaging 1.00
R2274:Rptor UTSW 11 119756322 nonsense probably null
R2275:Rptor UTSW 11 119756322 nonsense probably null
R2408:Rptor UTSW 11 119857451 missense probably damaging 0.99
R2981:Rptor UTSW 11 119865594 missense probably damaging 1.00
R2996:Rptor UTSW 11 119856298 missense probably damaging 1.00
R3001:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3002:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R3003:Rptor UTSW 11 119872371 missense possibly damaging 0.94
R4358:Rptor UTSW 11 119671345 missense probably damaging 0.98
R4592:Rptor UTSW 11 119798840 missense probably null 1.00
R4647:Rptor UTSW 11 119891163 missense probably benign 0.33
R4666:Rptor UTSW 11 119743882 missense probably damaging 1.00
R4958:Rptor UTSW 11 119857391 missense probably benign 0.29
R4974:Rptor UTSW 11 119821640 intron probably benign
R5073:Rptor UTSW 11 119896479 missense possibly damaging 0.71
R5199:Rptor UTSW 11 119603816 missense probably benign
R5216:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5219:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5277:Rptor UTSW 11 119822956 missense probably damaging 1.00
R5365:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5366:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5447:Rptor UTSW 11 119843713 missense probably damaging 0.98
R5630:Rptor UTSW 11 119756249 missense probably benign 0.01
R6220:Rptor UTSW 11 119897442 missense possibly damaging 0.83
R6567:Rptor UTSW 11 119896012 missense probably benign 0.00
R6741:Rptor UTSW 11 119895977 missense possibly damaging 0.92
R6915:Rptor UTSW 11 119756345 missense probably damaging 0.99
R7032:Rptor UTSW 11 119846936 missense probably benign 0.00
R7051:Rptor UTSW 11 119874186 utr 3 prime probably benign
R7396:Rptor UTSW 11 119872355 missense probably benign 0.10
R7429:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7430:Rptor UTSW 11 119846828 missense probably damaging 1.00
R7447:Rptor UTSW 11 119884979 missense probably benign 0.00
X0050:Rptor UTSW 11 119846405 missense probably benign 0.14
X0066:Rptor UTSW 11 119857866 missense probably benign 0.31
Z0001:Rptor UTSW 11 119603972 critical splice donor site probably null
Z0001:Rptor UTSW 11 119756236 splice site probably null
Z0001:Rptor UTSW 11 119756415 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119799319 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119846752 critical splice acceptor site probably null
Z0001:Rptor UTSW 11 119851468 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119857453 critical splice donor site probably benign
Z0001:Rptor UTSW 11 119871492 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119874151 critical splice acceptor site probably benign
Z0001:Rptor UTSW 11 119896549 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- ACTCAGCTTTGGCAAGTGGCAG -3'
(R):5'- TGTGGGGAGTGGAATGACCCTAAAC -3'

Sequencing Primer
(F):5'- TTCCCCGAGGTGACATTATCAAG -3'
(R):5'- AGTGGAATGACCCTAAACTAAGG -3'
Posted On2013-07-30